G1127820



Basic Information


Item Value
gene id G1127820
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 92899780 ~ 92911820 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1282813
gtatcatgatagacccctggtctctacaggtgaatgttaacacaatgtatcatgacagacccctggtctctgaaggtgaatgttaacacaatgtatcatgacagacccctggtctctgaaggtgaatgttaacacaatgtatcatgacaggtccctggtctctgaaggtgaatgttaacacaatgtatcatgacagacccctggtctctacaggtgaatgttaacacaatgtatcatgacaggtccctggtctctgaaggtgaatgttaacacaatgtatcatgacaggtccctggtctctacaggtgaatgttaacacaatgtatcatgac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1282813 True 332 lncRNA 0.43 2 92899780 92911820

Neighbor


gene id symbol gene type direction distance location
LOC110487086 LOC106601910 coding downstream 22600 92873659 ~ 92877180 (-)
LOC110516409 LOC106594801 coding downstream 97635 92598880 ~ 92802145 (-)
LOC110486090 LOC105012845 coding downstream 373741 92503706 ~ 92526039 (-)
LOC110486093 LOC106606427 coding downstream 413516 92458493 ~ 92486264 (-)
LOC110513965 lg3bp coding downstream 812266 92081486 ~ 92087514 (-)
LOC118937833 otop2 coding upstream 36755 92948575 ~ 92952718 (-)
LOC110487082 otop2 coding upstream 49849 92961669 ~ 92992081 (-)
LOC110487425 LOC106606392 coding upstream 104343 93016163 ~ 93018006 (-)
LOC110487427 LOC106606390 coding upstream 132247 93044067 ~ 93099141 (-)
LOC118937781 LOC106606397 coding upstream 154860 93066680 ~ 93074303 (-)
G1127815 NA non-coding downstream 1515 92898047 ~ 92898265 (-)
G1127799 NA non-coding downstream 27365 92871977 ~ 92872415 (-)
G1127793 NA non-coding downstream 39493 92860057 ~ 92860287 (-)
G1127792 NA non-coding downstream 45672 92850300 ~ 92854108 (-)
G1127953 NA non-coding upstream 886 92912706 ~ 92913143 (-)
G1127964 NA non-coding upstream 28226 92940046 ~ 92941670 (-)
G1127987 NA non-coding upstream 82374 92994194 ~ 92995045 (-)
G1127991 NA non-coding upstream 86599 92998419 ~ 93005755 (-)
G1127992 NA non-coding upstream 88740 93000560 ~ 93001801 (-)
G1127739 NA other downstream 144648 92754879 ~ 92755132 (-)
G1127735 NA other downstream 151565 92747794 ~ 92748215 (-)
G1127726 NA other downstream 181313 92715049 ~ 92718467 (-)
LOC110487457 LOC106606216 other upstream 478282 93381051 ~ 93392268 (-)
G1128567 LOC106606382 other upstream 662245 93574065 ~ 93577988 (-)
G1128609 NA other upstream 777865 93689685 ~ 93690320 (-)
G1128616 NA other upstream 791175 93702995 ~ 93707636 (-)
p-ras LOC101485266 other upstream 803378 93715163 ~ 93725341 (-)

Expression


G1127820 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G1127820 Expression in each Bioproject

Bar chart with 10 bars.
G1127820 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network