G1128032



Basic Information


Item Value
gene id G1128032
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 93115134 ~ 93162598 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1283078
cctgtatatagcccccacactgactcggtaccggtaccccctgtatatagcccccacactgactcggtaccggtaccccctgtatatagcctccacactgactcggtaccggtacaccctgtatatagcccccacactgactcggtaccggtaccccctgtatatagcccccacactgactcggtaccggtaccccctgtatataacctccacactgactcggtaccggtaccccctgtatatagcccccacactgactcggtaccggtaccccctgtatataacctccacactgactcggtaccggtacacccctgtatatagcccccacactgactcggtaccggtaccccctgtgtatagcctc
>TU1283080
cacactgactcggtaccggtacacccctgtatatagcccccacactgactcggtaccggtaccccctgtatatagcccccacactgactcggtaccggtaccccctgtatataacctccacactgactcggtaccggtaccccctgtatatagcccccacactgactcggtaccggtaccccctgtatataacctccacactgactcggtaccggtacaccctgtatatagcctccacactgactcggtaccggtaccccctgtatatagcctccacactgactcggtaccggtacaccctgtatatagcctc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1283078 False 367 lncRNA 0.57 2 93115134 93162496
TU1283080 True 313 lncRNA 0.56 2 93162092 93162598

Neighbor


gene id symbol gene type direction distance location
LOC110487427 LOC106606390 coding downstream 15993 93044067 ~ 93099141 (-)
LOC118937782 NA coding downstream 30514 93081665 ~ 93084620 (-)
LOC118937781 LOC106606397 coding downstream 40831 93066680 ~ 93074303 (-)
LOC110487425 LOC106606392 coding downstream 97128 93016163 ~ 93018006 (-)
LOC110487082 otop2 coding downstream 123053 92961669 ~ 92992081 (-)
LOC110487466 NA coding upstream 413 93163011 ~ 93165988 (-)
LOC110487450 LOC106602060 coding upstream 9423 93172021 ~ 93186655 (-)
LOC110518132 mkk6a coding upstream 123855 93286453 ~ 93311362 (-)
LOC110485279 LOC106601935 coding upstream 150315 93312913 ~ 93318606 (-)
LOC110487442 trub1 coding upstream 202803 93365401 ~ 93366860 (-)
G1128030 LOC106602060 non-coding downstream 175 93114506 ~ 93114959 (-)
G1128004 NA non-coding downstream 79076 93035851 ~ 93036058 (-)
G1128002 NA non-coding downstream 81940 93032020 ~ 93033194 (-)
G1128000 LOC106602066 non-coding downstream 85414 93029127 ~ 93029720 (-)
G1127999 NA non-coding downstream 86143 93026856 ~ 93028991 (-)
G1128069 NA non-coding upstream 62527 93225125 ~ 93225345 (-)
G1128077 NA non-coding upstream 70268 93232866 ~ 93233404 (-)
G1128079 NA non-coding upstream 73636 93236234 ~ 93237397 (-)
G1128103 NA non-coding upstream 107395 93269993 ~ 93270229 (-)
G1128106 NA non-coding upstream 109102 93271700 ~ 93271951 (-)
G1127792 NA other downstream 261026 92850300 ~ 92854108 (-)
G1127739 NA other downstream 360002 92754879 ~ 92755132 (-)
G1127735 NA other downstream 366919 92747794 ~ 92748215 (-)
G1127726 NA other downstream 396667 92715049 ~ 92718467 (-)
LOC110516409 LOC106594801 other downstream 480410 92598880 ~ 92802145 (-)
LOC110487457 LOC106606216 other upstream 227504 93381051 ~ 93392268 (-)
G1128567 LOC106606382 other upstream 411467 93574065 ~ 93577988 (-)
G1128609 NA other upstream 527087 93689685 ~ 93690320 (-)
G1128616 NA other upstream 540397 93702995 ~ 93707636 (-)
p-ras LOC101485266 other upstream 552600 93715163 ~ 93725341 (-)

Expression


G1128032 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G1128032 Expression in each Bioproject

Bar chart with 20 bars.
G1128032 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network