G1128789



Basic Information


Item Value
gene id G1128789
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 94155689 ~ 94155917 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1284072
cctcaggagactgaaaacatttggcatgggtccccagatcctcaaaaagttctacagctgcaccatcgagagcatcctgaccgtttgcatcaccacctggtacggcaactgctcgacatctgacccataaggtgctacagagggtaatgcgtacggcccagtacatcactggggccaaggacctactgtatataataggcggtgtcagaggaaagcccataaaattgtc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1284072 True 229 lncRNA 0.51 1 94155689 94155917
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110507112 LOC106596372 coding downstream 17027 94135129 ~ 94138662 (-)
LOC110514005 LOC106601187 coding downstream 182546 93944638 ~ 93973143 (-)
LOC118937783 LOC105029051 coding downstream 316062 93803068 ~ 93839627 (-)
LOC118937784 LOC105029052 coding downstream 360279 93729019 ~ 93795410 (-)
p-ras LOC101485266 coding downstream 430375 93715163 ~ 93725341 (-)
LOC110487111 LOC106606373 coding upstream 24045 94179962 ~ 94190977 (-)
LOC118937791 NA coding upstream 29558 94185475 ~ 94188149 (-)
LOC118937795 LOC106601473 coding upstream 193825 94349742 ~ 94357254 (-)
LOC110513422 LOC106606297 coding upstream 204422 94360207 ~ 94369276 (-)
LOC110513417 LOC106606297 coding upstream 214921 94370838 ~ 94376967 (-)
G1128763 LOC106606375 non-coding downstream 16006 94123475 ~ 94139683 (-)
G1128759 LOC106606375 non-coding downstream 24775 94129173 ~ 94130914 (-)
G1128764 NA non-coding downstream 30377 94123972 ~ 94125312 (-)
G1128777 NA non-coding downstream 37399 94118051 ~ 94118290 (-)
G1128776 NA non-coding downstream 38533 94116920 ~ 94117156 (-)
G1128806 NA non-coding upstream 84093 94240010 ~ 94241908 (-)
G1128821 LOC106606284 non-coding upstream 112901 94268818 ~ 94272567 (-)
G1128760 NA non-coding upstream 121645 94277562 ~ 94282382 (-)
G1129092 LOC106606287 non-coding upstream 129036 94284953 ~ 94285538 (-)
G1129143 NA non-coding upstream 191891 94347808 ~ 94355963 (-)
G1128731 LOC106595797 other downstream 39505 94006578 ~ 94116184 (-)
G1128616 NA other downstream 448053 93702995 ~ 93707636 (-)
G1128609 NA other downstream 465369 93689685 ~ 93690320 (-)
G1128567 LOC106606382 other downstream 577701 93574065 ~ 93577988 (-)
G1128814 NA other upstream 95084 94251001 ~ 94252388 (-)
G1128822 LOC106606284 other upstream 118645 94274562 ~ 94275182 (-)
LOC110511881 LOC106606292 other upstream 295698 94450540 ~ 94464106 (-)
G1129544 NA other upstream 936705 95092622 ~ 95093093 (-)

Expression


G1128789 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1128789 Expression in each Bioproject

Bar chart with 14 bars.
G1128789 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network