G1132196



Basic Information


Item Value
gene id G1132196
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 99024656 ~ 99024928 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1288693
AAACACATTAGTATAATAGACAGTGAGATCCTAAAAGAGAATAAACACATTAGTATAATAGACAGTGAGATCCTAAAAGAGAATAAACACATTAGTATAACAGTGAGATCCTAAAAGAGAATAAACACATTAGTATAACAGTGAGATCCTAAAAGAGAATAAACACATTAGTATAATAGACAGTGAGATCCTGACACAGACAGGTCCAACAAGCTACGGAATGCACCTTCT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1288693 True 231 lncRNA 0.33 2 99024656 99024928

Neighbor


gene id symbol gene type direction distance location
LOC110516605 LOC106592968 coding upstream 47410 98976333 ~ 98977246 (+)
LOC110487124 LOC105006040 coding upstream 460417 98425760 ~ 98564239 (+)
LOC118936514 smim22 coding upstream 758629 98259570 ~ 98268855 (+)
LOC110516721 LOC105012791 coding upstream 806371 98187732 ~ 98218285 (+)
LOC118937837 LOC106594247 coding upstream 902578 98101643 ~ 98122078 (+)
LOC110539183 LOC106606365 coding downstream 46068 99070996 ~ 99088300 (+)
epn3a LOC105006167 coding downstream 92473 99117401 ~ 99175955 (+)
LOC110538843 LOC106601911 coding downstream 158189 99183117 ~ 99188055 (+)
LOC110538844 tbcd coding downstream 163957 99188885 ~ 99322871 (+)
LOC110485297 LOC106592354 coding downstream 670678 99695572 ~ 99698337 (+)
G1132192 NA non-coding upstream 11724 99010288 ~ 99012932 (+)
G1132188 NA non-coding upstream 20531 99003371 ~ 99004125 (+)
G1132087 NA non-coding upstream 43029 98980410 ~ 98981627 (+)
G1132173 NA non-coding upstream 50575 98973762 ~ 98974081 (+)
G1132197 NA non-coding downstream 108 99025036 ~ 99025357 (+)
G1132202 NA non-coding downstream 9195 99034123 ~ 99035585 (+)
G1132206 NA non-coding downstream 15908 99040836 ~ 99041335 (+)
G1132211 NA non-coding downstream 22981 99047909 ~ 99048138 (+)
G1132214 NA non-coding downstream 25048 99049976 ~ 99050469 (+)
G1132187 NA other upstream 22883 99001356 ~ 99001773 (+)
G1132174 NA other upstream 49730 98974443 ~ 98974926 (+)
G1132093 NA other upstream 227144 98795758 ~ 98797512 (+)
G1132082 NA other upstream 241329 98782139 ~ 98783327 (+)
G1132058 NA other upstream 257399 98762440 ~ 98767257 (+)
LOC110513175 LOC106603827 other downstream 780106 99805034 ~ 99817184 (+)

Expression


G1132196 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

G1132196 Expression in each Bioproject

Bar chart with 5 bars.
G1132196 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network