G1133751


Basic Information

Item Value
gene id G1133751
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 102037541 ~ 102040791 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1290907
ccaccactctaaccactagtctatctgaccagaccagttactgacccaccactctaaccactagtctatctgaccataccagttactgacccaccactctaaccactaggttacctgaccataccataccagttactgacccaacactctaaccactagtctatctgaccataccagttactgacccaccactctaaccactagtctatctgaccataccagttactgacccaccactctaaccactagtctatctgaccataccagttactgacccaccactctaaccactagtctacctgaccataccagttactgac
>TU1290906
gttactgacccaccactctaaccactagtctatctgaccataccagttactgacccaccactctaaccactagtctatctgaccataccagttactgacccaccactctaaccactagtctatctgaccataccagttactgacccaccactctaaccactagtctaactgaccataccagttactgacccaccactctaaccactagtctacctgaccataccagttactgac
>TU1290905
ctagtctatctgaccataccagttactgacccaccactctaaccactagtatatctgaccataccagttactgacccaccactctaaccactagtctatctgaccataccagttactgacccaacactctaaccactagtctatctgaccataccagttactgacccaccactctaaccactagtctatctgaccataccagttactgacccaccactctaaccactagtctacctgaccataccagttactgac
>TU1290903
cccaccactctaaccactagtctatctgaccataccagttactgacccaccactctaaccactagtctatctgaccataccagttactgacccaccactctaaccactagtataTCTGACCagaccagttactgacccaacactctaaccactagtctgtctgaccataccagttactgacccaacactctaaccactagtctgtCTGAC
>TU1290904
ataccagttactgacctaccactctaaccactagtctatctgaccataccagttactgacccaccactctaaccactagtctatctgaccataccagttactgacccaccactctaaccactagtctacctgaccataccagttactgacccaccactctaaccactagtctacctgaccataccataccagttactgacccaacactctaaccactagtctgtCTGAC

Function

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1290907 False 320 lncRNA 0.47 3 102037541 102040672
TU1290906 False 234 lncRNA 0.47 2 102037856 102040672
TU1290905 False 255 lncRNA 0.46 3 102038316 102040672
TU1290903 False 210 lncRNA 0.47 2 102038435 102040791
TU1290904 True 229 lncRNA 0.47 2 102040478 102040791
Loading

Neighbor

gene id symbol gene type direction distance location
LOC118937868 NA coding upstream 50205 101970611 ~ 101987336 (+)
LOC118937840 LOC106603827 coding upstream 300381 101717789 ~ 101737160 (+)
LOC110510646 LOC106603827 coding upstream 431847 101299907 ~ 101605694 (+)
LOC118937611 LOC106603827 coding upstream 457900 101572952 ~ 101579641 (+)
LOC110516410 LOC106581607 coding upstream 646678 101347420 ~ 101390863 (+)
LOC118937844 LOC106603753 coding downstream 547464 102588255 ~ 102747507 (+)
LOC110516933 LOC106603753 coding downstream 707143 102747839 ~ 102766589 (+)
LOC118937867 LOC106603827 coding downstream 713180 102753971 ~ 102756123 (+)
LOC118937845 LOC106603753 coding downstream 745517 102786308 ~ 102791744 (+)
LOC118937839 LOC106603753 coding downstream 793834 102834625 ~ 102846630 (+)
G1133685 NA non-coding upstream 9063 101780097 ~ 102028478 (+)
G1133745 NA non-coding upstream 10276 102025523 ~ 102027265 (+)
G1133732 NA non-coding upstream 13491 101947066 ~ 102024050 (+)
G1133678 NA non-coding upstream 31148 101745618 ~ 102006393 (+)
G1133363 NA non-coding upstream 45533 101888504 ~ 101992008 (+)
G1133752 NA non-coding downstream 1563 102042354 ~ 102043073 (+)
G1133755 NA non-coding downstream 5446 102046237 ~ 102046712 (+)
G1133757 NA non-coding downstream 7807 102048598 ~ 102049178 (+)
G1133761 NA non-coding downstream 13597 102054388 ~ 102056072 (+)
G1133763 NA non-coding downstream 17984 102058775 ~ 102063803 (+)
G1133406 LOC106603827 other upstream 98885 101935217 ~ 101938656 (+)
G1133665 NA other upstream 345566 101691427 ~ 101691975 (+)
G1133510 NA other upstream 867281 101156993 ~ 101170260 (+)
G1133359 LOC106603827 other upstream 883222 101150287 ~ 101154319 (+)
G1133325 NA other upstream 1236531 100799542 ~ 100801010 (+)
G1133794 NA other downstream 90337 102131128 ~ 102135084 (+)
LOC110539186 LOC106603753 other downstream 426936 101670409 ~ 102479291 (+)
G1133958 NA other downstream 605856 102646647 ~ 102686598 (+)
G1133977 NA other downstream 677771 102718562 ~ 102719478 (+)

Expression

G1133751 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 100.
End of interactive chart.

G1133751 Expression in each Bioproject

Bar chart with 17 bars.
G1133751 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network