LOC118938573



Basic Information


Item Value
gene id LOC118938573
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 18220680 ~ 18220823 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005035781.1
TCAGCACACAATTAAAGCCTGACACCGTCTGATGTCTGTGTTCAGGTGTCGGAAGTGTGCCAGAGTGATCCGGCCTGGTTTTCGCTAACATCAGTAGGGCTGCTGCCCAATGACTGGAGTTTGATAGTGACCTGAGCCACAATG

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005035781.1 True 144 mRNA 0.51 1 18220680 18220823
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110485796 LOC106586953 coding upstream 2655 18203617 ~ 18218025 (+)
LOC110485098 LOC106564685 coding upstream 18084 18174911 ~ 18202596 (+)
LOC110485795 LOC106586907 coding upstream 51007 18132055 ~ 18169673 (+)
LOC110485794 LOC106586900 coding upstream 95795 18122169 ~ 18124885 (+)
LOC110485792 LOC106586869 coding upstream 144204 18069766 ~ 18076476 (+)
LOC118938572 NA coding downstream 1192 18222015 ~ 18222156 (+)
LOC118938622 NA coding downstream 3350 18224173 ~ 18224291 (+)
LOC110485797 LOC106586973 coding downstream 4349 18225172 ~ 18235534 (+)
LOC110485799 LOC106586988 coding downstream 15220 18236043 ~ 18250838 (+)
ntn1a LOC105012279 coding downstream 251034 18471857 ~ 18569139 (+)
G1150120 NA non-coding upstream 164061 18051611 ~ 18056619 (+)
G1150119 NA non-coding upstream 169409 18050864 ~ 18051271 (+)
G1150116 NA non-coding upstream 171202 18049146 ~ 18049478 (+)
G1150109 NA non-coding upstream 176652 18043427 ~ 18044028 (+)
G1150108 NA non-coding upstream 177349 18042732 ~ 18043331 (+)
G1150206 NA non-coding downstream 32425 18253248 ~ 18256354 (+)
G1150268 NA non-coding downstream 130945 18351768 ~ 18351976 (+)
G1150274 NA non-coding downstream 146582 18367405 ~ 18372997 (+)
G1150293 NA non-coding downstream 175788 18396611 ~ 18464572 (+)
G1148286 NA other upstream 1510569 16708824 ~ 16710111 (+)
G1147590 LOC106586738 other upstream 1913147 16300976 ~ 16307533 (+)
G1147529 NA other upstream 2020053 16199471 ~ 16200627 (+)
LOC110485768 LOC106564707 other upstream 2119330 15965856 ~ 16104020 (+)
G1146820 LOC106588633 other upstream 2778821 15438658 ~ 15441859 (+)
G1150536 NA other downstream 606563 18827386 ~ 18827882 (+)
LOC110485813 LOC106587120 other downstream 631588 18852294 ~ 18855764 (+)
G1151061 LOC106587131 other downstream 676245 18897068 ~ 18920852 (+)

Expression


LOC118938573 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 80.
End of interactive chart.

LOC118938573 Expression in each Bioproject

Bar chart with 17 bars.
LOC118938573 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network