LOC118938572



Basic Information


Item Value
gene id LOC118938572
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 18222015 ~ 18222156 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005035780.1
ACGGCACACAATTAAAGCCTGGCACTGTGACATCTGTGTTCAGGTGTCGGAAGTGTGCCAGAGTGATCTGGCCGGGTTTTCGCTAACATCAGTAGGGCTGCTGCCCAATGACTGGAGTTTGATAGTGACCTGAGCCACAACC

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005035780.1 True 142 mRNA 0.53 1 18222015 18222156

Neighbor


gene id symbol gene type direction distance location
LOC118938573 NA coding upstream 1192 18220680 ~ 18220823 (+)
LOC110485796 LOC106586953 coding upstream 3990 18203617 ~ 18218025 (+)
LOC110485098 LOC106564685 coding upstream 19419 18174911 ~ 18202596 (+)
LOC110485795 LOC106586907 coding upstream 52342 18132055 ~ 18169673 (+)
LOC110485794 LOC106586900 coding upstream 97130 18122169 ~ 18124885 (+)
LOC118938622 NA coding downstream 2017 18224173 ~ 18224291 (+)
LOC110485797 LOC106586973 coding downstream 3016 18225172 ~ 18235534 (+)
LOC110485799 LOC106586988 coding downstream 13887 18236043 ~ 18250838 (+)
ntn1a LOC105012279 coding downstream 249701 18471857 ~ 18569139 (+)
LOC110485807 LOC106564674 coding downstream 396920 18619076 ~ 18623922 (+)
G1150120 NA non-coding upstream 165396 18051611 ~ 18056619 (+)
G1150119 NA non-coding upstream 170744 18050864 ~ 18051271 (+)
G1150116 NA non-coding upstream 172537 18049146 ~ 18049478 (+)
G1150109 NA non-coding upstream 177987 18043427 ~ 18044028 (+)
G1150108 NA non-coding upstream 178684 18042732 ~ 18043331 (+)
G1150206 NA non-coding downstream 31092 18253248 ~ 18256354 (+)
G1150268 NA non-coding downstream 129612 18351768 ~ 18351976 (+)
G1150274 NA non-coding downstream 145249 18367405 ~ 18372997 (+)
G1150293 NA non-coding downstream 174455 18396611 ~ 18464572 (+)
G1148286 NA other upstream 1511904 16708824 ~ 16710111 (+)
G1147590 LOC106586738 other upstream 1914482 16300976 ~ 16307533 (+)
G1147529 NA other upstream 2021388 16199471 ~ 16200627 (+)
LOC110485768 LOC106564707 other upstream 2120665 15965856 ~ 16104020 (+)
G1146820 LOC106588633 other upstream 2780156 15438658 ~ 15441859 (+)
G1150536 NA other downstream 605230 18827386 ~ 18827882 (+)
LOC110485813 LOC106587120 other downstream 630255 18852294 ~ 18855764 (+)
G1151061 LOC106587131 other downstream 674912 18897068 ~ 18920852 (+)

Expression


LOC118938572 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 60.
End of interactive chart.

LOC118938572 Expression in each Bioproject

Bar chart with 18 bars.
LOC118938572 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network