G1135525



Basic Information


Item Value
gene id G1135525
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 1685641 ~ 1685938 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1293436
ccatattacctcaacagtatttaacattatccagatactgactgtctatagcagcttcccaccagaatgggctttaggtgaggcagatgaacctgtagccatattacctcaacagtatttaacattatccagatactgactgtctatagcagcttcccaccagaatgggctttaggtgaggcagatgaacctgtagccat

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1293436 True 200 lncRNA 0.43 2 1685641 1685938
Loading

Neighbor


gene id symbol gene type direction distance location
trnai-uau-2 NA coding upstream 4057 1681491 ~ 1681584 (+)
LOC118938505 NA coding upstream 9349 1674392 ~ 1676292 (+)
LOC118938401 LOC106595670 coding upstream 22410 1655082 ~ 1663231 (+)
LOC110506152 LOC106595687 coding upstream 45334 1634751 ~ 1640307 (+)
LOC118938396 LOC106595654 coding upstream 58243 1623073 ~ 1627806 (+)
LOC118938392 NA coding downstream 60610 1746548 ~ 1755488 (+)
LOC118938415 LOC106607542 coding downstream 73792 1759730 ~ 1791753 (+)
LOC110487324 LOC106593751 coding downstream 118139 1804077 ~ 1811394 (+)
LOC118938414 LOC106607538 coding downstream 129163 1815101 ~ 1824260 (+)
LOC118938407 LOC106593232 coding downstream 143838 1829776 ~ 1840280 (+)
G1135517 NA non-coding upstream 14110 1670877 ~ 1671531 (+)
G1135516 NA non-coding upstream 15697 1664703 ~ 1669944 (+)
G1135515 NA non-coding upstream 24734 1658988 ~ 1660907 (+)
G1135481 NA non-coding upstream 95663 1589409 ~ 1589978 (+)
G1135528 NA non-coding downstream 3341 1689279 ~ 1689763 (+)
G1135553 NA non-coding downstream 42184 1728122 ~ 1729342 (+)
G1135558 NA non-coding downstream 75130 1761068 ~ 1776921 (+)
G1135559 NA non-coding downstream 85660 1771598 ~ 1776646 (+)
G1135355 NA other upstream 299838 1382438 ~ 1385803 (+)
G1135135 NA other upstream 380270 1302239 ~ 1305371 (+)
G1135108 NA other upstream 745630 875652 ~ 1318383 (+)
G1135265 LOC106586052 other upstream 833484 839169 ~ 852157 (+)
G1135455 LOC106607538 other downstream 118435 1804373 ~ 1823552 (+)
LOC118938404 LOC106594479 other downstream 228933 1914705 ~ 1935643 (+)
G1135625 NA other downstream 314371 2000309 ~ 2068901 (+)
G1135672 NA other downstream 626915 2282956 ~ 2429608 (+)
G1136602 LOC106613263 other downstream 897359 2583297 ~ 2584334 (+)

Expression


G1135525 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1135525 Expression in each Bioproject

Bar chart with 19 bars.
G1135525 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network