G1139415



Basic Information


Item Value
gene id G1139415
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 7142921 ~ 7143171 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1298895
CTGTTAAGGAGTCCTTGATGTGTTGGATGGAGGTCAGTCAGATTCTCTGTTAATAAGGAGTCCTTGATGTGTTGGATGGAGGTCAGTCAGATTCTCTGTTAATAAGGAGTCCTTGATGTGTTGGATGGAGGTCAGTCAGATTCTCTGTTAATAAGGAGTCCTTGATGTGTTGGATGGAGGTCAGTCAGATTCTCTGTTAAGGAGTCCTTGATGTGTTGGATGGAGGTCAGTCAGATTCTCTGTTAATAAGG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1298895 True 251 lncRNA 0.43 1 7142921 7143171

Neighbor


gene id symbol gene type direction distance location
LOC110513552 LOC106591328 coding upstream 9123 7101953 ~ 7133802 (+)
LOC118938519 LOC106591213 coding upstream 59617 7080815 ~ 7083304 (+)
LOC110515840 LOC106593162 coding upstream 59739 7064271 ~ 7083182 (+)
LOC110513670 LOC106593154 coding upstream 170501 6950331 ~ 6972420 (+)
LOC110495035 LOC106593154 coding upstream 203377 6917898 ~ 6939544 (+)
LOC110517645 cssa12h10orf76 coding downstream 4467 7147638 ~ 7210032 (+)
LOC110485502 kcnip2 coding downstream 94396 7237567 ~ 7280710 (+)
LOC118938182 LOC106591493 coding downstream 603230 7746401 ~ 7761076 (+)
LOC110485616 LOC106591151 coding downstream 619637 7762808 ~ 7888033 (+)
LOC110485612 LOC106591159 coding downstream 864643 8007814 ~ 8032920 (+)
G1139412 NA non-coding upstream 15777 7123182 ~ 7127144 (+)
G1139407 NA non-coding upstream 49173 7093546 ~ 7093748 (+)
G1139403 NA non-coding upstream 55185 7087427 ~ 7087736 (+)
G1139397 NA non-coding upstream 101933 7039864 ~ 7040988 (+)
G1139421 NA non-coding downstream 20880 7164051 ~ 7164399 (+)
G1139422 NA non-coding downstream 25427 7168598 ~ 7230355 (+)
G1139423 NA non-coding downstream 25955 7169126 ~ 7169953 (+)
G1139431 NA non-coding downstream 56151 7199322 ~ 7202796 (+)
G1139447 NA non-coding downstream 104577 7247748 ~ 7248278 (+)
LOC110485388 LOC106592846 other upstream 801033 6336889 ~ 6375515 (+)
LOC110513590 NA other upstream 960880 6179347 ~ 6185375 (+)
G1138908 NA other upstream 1050873 5885765 ~ 6092048 (+)
G1138909 NA other upstream 1128198 5878360 ~ 6014723 (+)
G1138894 NA other upstream 1301697 5839853 ~ 5841224 (+)
G1139553 NA other downstream 332203 7475374 ~ 7502281 (+)
G1139317 NA other downstream 382421 7525592 ~ 7527157 (+)

Expression


G1139415 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1139415 Expression in each Bioproject

Bar chart with 10 bars.
G1139415 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network