G1139709



Basic Information


Item Value
gene id G1139709
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 7871659 ~ 7873903 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1299265
caggacattctatagacattctctcaggacattctttagacattctctcaggacattctatagacattctctctagacattctctcaggacattctatagacattctcccaggacattctatagacattctcccaggacattctatagacattctctcaggacattctttagacattctctcaggacattctatagacattctctcaggacattctttagacattctctcaggacattctatagacattctcccaggacattctatagacattctctcaggacattctatagacattctctcaggacattctatagacattctctcaggacattctatagacattctctcaggacattctatagacattctcccaggacattctatag

Function


NR:

description
PREDICTED: uncharacterized protein DKFZp434B061-like, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1299265 True 388 lncRNA 0.39 2 7871659 7873903
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118938182 LOC106591493 coding upstream 110583 7746401 ~ 7761076 (+)
LOC110485502 kcnip2 coding upstream 590949 7237567 ~ 7280710 (+)
LOC110517645 cssa12h10orf76 coding upstream 661627 7147638 ~ 7210032 (+)
LOC110513552 LOC106591328 coding upstream 737861 7101953 ~ 7133802 (+)
LOC118938519 LOC106591213 coding upstream 788355 7080815 ~ 7083304 (+)
LOC110485612 LOC106591159 coding downstream 133911 8007814 ~ 8032920 (+)
LOC110511650 LOC106591308 coding downstream 207477 8081380 ~ 8096851 (+)
LOC110485576 LOC106591187 coding downstream 291467 8165370 ~ 8168323 (+)
LOC110487245 LOC106564368 coding downstream 327138 8201041 ~ 8217219 (+)
LOC110487246 LOC106564362 coding downstream 402550 8276453 ~ 8318343 (+)
G1139705 NA non-coding upstream 10738 7860525 ~ 7860921 (+)
G1139696 NA non-coding upstream 31513 7839555 ~ 7840146 (+)
G1139695 NA non-coding upstream 32309 7839091 ~ 7839350 (+)
G1139694 NA non-coding upstream 33246 7838194 ~ 7838413 (+)
G1139693 NA non-coding upstream 36324 7835133 ~ 7835335 (+)
G1139711 NA non-coding downstream 5162 7879065 ~ 7879310 (+)
G1139713 NA non-coding downstream 8511 7882414 ~ 7882934 (+)
LOC110485616 LOC106591151 non-coding downstream 9970 7762808 ~ 7888033 (+)
G1140599 NA non-coding downstream 36722 7910625 ~ 7911039 (+)
G1140601 NA non-coding downstream 38777 7912680 ~ 7915538 (+)
G1139317 NA other upstream 344502 7525592 ~ 7527157 (+)
G1139553 NA other upstream 369378 7475374 ~ 7502281 (+)
G1140682 NA other downstream 260097 8134000 ~ 8134822 (+)
LOC118938189 LOC106591430 other downstream 697100 8570729 ~ 8594285 (+)
G1140953 NA other downstream 767245 8641148 ~ 8694875 (+)
cbx6a cbx6 other downstream 917296 8790681 ~ 8810954 (+)
LOC110487255 LOC106591397 other downstream 962782 8828237 ~ 8840946 (+)

Expression


G1139709 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1139709 Expression in each Bioproject

Bar chart with 11 bars.
G1139709 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network