G1139711



Basic Information


Item Value
gene id G1139711
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 7879065 ~ 7879310 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1299268
ATCATATAGTCTCTTGTCCTTATCATATAGTCTCTAGGCCTTATCATATAGTCTCTAGGCCTTATCATATAGTCTCTTGTCCTTATCATATAGTCTCTTGTCCTTATCATATAGTCTCTTGTCCTTATCATATAGTCTCTTGTCATCATATAGTCTTTTGTCATTATCATATAGTCTCTTGTCCTTATCATATAGTCTCTTGTCCTTATCATATAGTCTCTTGTCCTTATCATATAGTCTCTTGTC

Function


NR:

description
serine/arginine repetitive matrix protein 2-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1299268 True 246 lncRNA 0.33 1 7879065 7879310
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118938182 LOC106591493 coding upstream 117989 7746401 ~ 7761076 (+)
LOC110485502 kcnip2 coding upstream 598355 7237567 ~ 7280710 (+)
LOC110517645 cssa12h10orf76 coding upstream 669033 7147638 ~ 7210032 (+)
LOC110513552 LOC106591328 coding upstream 745267 7101953 ~ 7133802 (+)
LOC118938519 LOC106591213 coding upstream 795761 7080815 ~ 7083304 (+)
LOC110485612 LOC106591159 coding downstream 128504 8007814 ~ 8032920 (+)
LOC110511650 LOC106591308 coding downstream 202070 8081380 ~ 8096851 (+)
LOC110485576 LOC106591187 coding downstream 286060 8165370 ~ 8168323 (+)
LOC110487245 LOC106564368 coding downstream 321731 8201041 ~ 8217219 (+)
LOC110487246 LOC106564362 coding downstream 397143 8276453 ~ 8318343 (+)
G1139709 NA non-coding upstream 5162 7871659 ~ 7873903 (+)
G1139705 NA non-coding upstream 18144 7860525 ~ 7860921 (+)
G1139696 NA non-coding upstream 38919 7839555 ~ 7840146 (+)
G1139695 NA non-coding upstream 39715 7839091 ~ 7839350 (+)
G1139694 NA non-coding upstream 40652 7838194 ~ 7838413 (+)
G1139713 NA non-coding downstream 3104 7882414 ~ 7882934 (+)
LOC110485616 LOC106591151 non-coding downstream 4563 7762808 ~ 7888033 (+)
G1140599 NA non-coding downstream 31315 7910625 ~ 7911039 (+)
G1140601 NA non-coding downstream 33370 7912680 ~ 7915538 (+)
G1140602 NA non-coding downstream 39947 7919257 ~ 7921396 (+)
G1139317 NA other upstream 351908 7525592 ~ 7527157 (+)
G1139553 NA other upstream 376784 7475374 ~ 7502281 (+)
G1140682 NA other downstream 254690 8134000 ~ 8134822 (+)
LOC118938189 LOC106591430 other downstream 691693 8570729 ~ 8594285 (+)
G1140953 NA other downstream 761838 8641148 ~ 8694875 (+)
cbx6a cbx6 other downstream 911889 8790681 ~ 8810954 (+)
LOC110487255 LOC106591397 other downstream 957375 8828237 ~ 8840946 (+)

Expression


G1139711 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1139711 Expression in each Bioproject

Bar chart with 9 bars.
G1139711 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network