G1142355



Basic Information


Item Value
gene id G1142355
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 10586436 ~ 10586812 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1302717
ATACACTCTATACACCAACAGATTCATCCCATTCTCCAATACACTCTATACCACACCAACAGATTCATCACATTCTCCAATACACTCTATATCACACCAACAGATTCATCACTTTCTCCAATACACTCTATATCACACCAACAGATTCATCACATTCTCCAATACACTCTATATCACACCAACAGATTCATCACATTCTCCAATACACTCTATATCACACTAATAGATTCATCACTTTCTCCAATACACTCTATATCACACCAACAGATTCATCACTTTCCCCAATACACTCTATATC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1302717 True 298 lncRNA 0.37 2 10586436 10586812
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110512091 LOC106590790 coding upstream 471879 10103316 ~ 10114557 (+)
LOC118936522 LOC106590702 coding upstream 493033 10088482 ~ 10093403 (+)
zgc:92360 LOC106564422 coding upstream 498632 10053959 ~ 10087804 (+)
LOC118938204 NA coding upstream 570581 10011327 ~ 10015855 (+)
LOC110493424 LOC106564439 coding upstream 587366 9975889 ~ 10004759 (+)
LOC118936325 NA coding downstream 74775 10661587 ~ 10670450 (+)
LOC110512270 LOC106593677 coding downstream 85386 10672198 ~ 10682184 (+)
LOC110485343 LOC101448032 coding downstream 95474 10682286 ~ 10694924 (+)
LOC110485345 LOC106593639 coding downstream 130439 10717251 ~ 10732453 (+)
LOC118938430 ier2 coding downstream 180896 10767708 ~ 10769374 (+)
G1142347 NA non-coding upstream 17054 10565217 ~ 10569382 (+)
G1142333 NA non-coding upstream 49530 10535579 ~ 10536906 (+)
G1142322 NA non-coding upstream 101383 10479905 ~ 10485053 (+)
G1142316 NA non-coding upstream 116630 10469254 ~ 10469806 (+)
G1142298 NA non-coding upstream 170343 10414551 ~ 10416093 (+)
G1142364 NA non-coding downstream 23192 10610004 ~ 10610332 (+)
G1142367 NA non-coding downstream 28767 10615579 ~ 10615860 (+)
G1142387 NA non-coding downstream 59781 10646593 ~ 10647830 (+)
G1142398 NA non-coding downstream 80341 10667153 ~ 10667813 (+)
G1142408 NA non-coding downstream 125705 10712517 ~ 10713747 (+)
G1142240 NA other upstream 287072 10296253 ~ 10299364 (+)
G1142146 NA other upstream 560202 10026017 ~ 10026234 (+)
LOC118938200 cyh2 other upstream 923914 9653992 ~ 9668271 (+)
G1141316 NA other upstream 961610 9623599 ~ 9624826 (+)
G1142381 NA other downstream 232928 10819740 ~ 10823255 (+)
G1142457 NA other downstream 309113 10895925 ~ 10896973 (+)
G1142964 NA other downstream 618083 11204895 ~ 11205243 (+)
LOC110485562 LOC106590570 other downstream 629867 11216669 ~ 11273353 (+)
G1143059 LOC106564453 other downstream 845926 11432738 ~ 11435550 (+)

Expression


G1142355 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1142355 Expression in each Bioproject

Bar chart with 5 bars.
G1142355 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network