G1145797


Basic Information

Item Value
gene id G1145797
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 14105064 ~ 14105861 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1306953
GAAGATCTCCACATTTTTATACTTGCAGTTATACTCTCCTGAGTATGAACTGTTATATGCTGTTATTTCCAAATTAAATGTTCTTGTTAATGTTTCAGGAGAAAAGAGAATATTCCATTCTTTTATCTTCTTTTGTTCTGGAGGCCCAGAGCAGACTAAGTTGCTGGAGCTCTGATTCATTGGGATGGTCACTTTGAGTTTGTAATGGACCGTTTCTCCTGCCAGAGCCACCCTGATTCTGTCCGGCATGGAGATGGCTGGGATGGCTTCTTGAGCCTGATGATTTCCCAAACACATCAGGACACACAGAACTCCAACCATCCAGATGCACATTTTGAAGAGACACCAAAGGTTTAGTTTTTCCCCTCTGTTTCTATTTGTTTGTGGTCACTTGAGATAGGAATACCTGTATCAGTATTGGAAGGATTTCGTCGAATTTCCCAAACCGTGTATGAGTGTCGCTTCAAGCCTTTCCCCTGTTCAGATTGCCCAGAATGGCCTCAGAGAGGTCGCAATACTGGGGTTCCTGTTTTGCC

Function

NR:

description
uncharacterized protein LOC109865823 isoform X1

GO: NA

KEGG:

id description

RNA

RNA id representative length rna type GC content exon number start site end site
TU1306953 True 536 lncRNA 0.43 2 14105064 14105861
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110485709 NA coding downstream 208333 13895588 ~ 13896731 (-)
LOC110485704 NA coding downstream 292995 13798679 ~ 13812239 (-)
smdt1b NA coding downstream 321934 13781575 ~ 13783130 (-)
LOC110485689 LOC106564549 coding downstream 342816 13753096 ~ 13762248 (-)
LOC110485690 sox10 coding downstream 371364 13728512 ~ 13733700 (-)
LOC110485713 LOC106588978 coding upstream 6665 14112526 ~ 14116588 (-)
LOC118936523 NA coding upstream 136742 14242603 ~ 14244662 (-)
LOC118938216 NA coding upstream 149619 14255480 ~ 14275408 (-)
LOC118938215 NA coding upstream 151672 14257533 ~ 14258326 (-)
LOC110485718 NA coding upstream 159819 14265680 ~ 14269377 (-)
G1145792 NA non-coding downstream 9670 14090947 ~ 14095394 (-)
G1145788 NA non-coding downstream 15686 14088689 ~ 14089378 (-)
G1145787 LOC106589277 non-coding downstream 16480 14088321 ~ 14088584 (-)
G1145742 NA non-coding downstream 79880 14000345 ~ 14025184 (-)
G1145733 NA non-coding downstream 123102 13981438 ~ 13981962 (-)
G1145801 NA non-coding upstream 12262 14118123 ~ 14118444 (-)
G1145807 LOC106589218 non-coding upstream 61187 14167048 ~ 14169211 (-)
G1145830 LOC103354157 non-coding upstream 71386 14177247 ~ 14180330 (-)
G1145843 NA non-coding upstream 96012 14201873 ~ 14210625 (-)
G1145881 NA non-coding upstream 171097 14276958 ~ 14277181 (-)
G1145790 NA other downstream 14277 14089658 ~ 14090787 (-)
G1145789 LOC106588930 other downstream 17497 14086952 ~ 14087567 (-)
LOC110485696 LOC106564559 other downstream 441444 13657453 ~ 13665295 (-)
G1145110 LOC106589620 other downstream 744256 13357074 ~ 13360808 (-)
G1146251 NA other upstream 604721 14710582 ~ 14711954 (-)
G1146446 NA other upstream 690805 14796666 ~ 14797272 (-)
G1146485 NA other upstream 816749 14922610 ~ 14925617 (-)
LOC110485744 LOC106588598 other upstream 1276299 15376146 ~ 15383913 (-)

Expression

G1145797 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1145797 Expression in each Bioproject

Bar chart with 15 bars.
G1145797 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network