G1146086


Basic Information

Item Value
gene id G1146086
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 14590976 ~ 14591741 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1307301
tgaggatctctgaatgatccaatgttgacctaaattactaatgatgataaatacaatccacctgtgtgtaatcaagtctccgtataaatgcacttgcactgtgatagtctcagaggtccgttaaaagcacagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagccggatttggatacaaaaagatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctggccgtccttctaaactttcagctcatacaaggagaagactgatcagagatgcagccaagaggcccgtgatcactctggatgaactgcagagatctacagctgaggtgggagactctgtccataggacaacaatcagtcgtatattgcacaaatctggcctttatggaagagtggcaagaagaaagccatttcttaaagatatccataaaaagtgttgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctctggtcagatgaaaccaaaattgaactttttggcaacaatgcaaaacgttatgtttggcgtaaaagcaacaaagctgaacacaccatccccactgtcaaacatggtggtggcagcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagat

Function

NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1307301 True 766 TUCP 0.43 1 14590976 14591741
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110485732 rps15a coding upstream 86703 14498997 ~ 14504273 (+)
notum2 LOC106564593 coding upstream 92607 14488705 ~ 14498369 (+)
coq7 coq7 coding upstream 113484 14471579 ~ 14477492 (+)
LOC118938217 LOC106588920 coding upstream 166471 14418140 ~ 14424505 (+)
LOC110485727 LOC106589116 coding upstream 221170 14362074 ~ 14369806 (+)
LOC110485738 LOC106564597 coding downstream 251799 14843540 ~ 14875152 (+)
LOC110485737 LOC106564584 coding downstream 319580 14911321 ~ 14946852 (+)
LOC110487288 LOC106564586 coding downstream 381076 14972693 ~ 14977535 (+)
LOC110485734 LOC105012206 coding downstream 474598 15066339 ~ 15118803 (+)
LOC110485739 LOC106588807 coding downstream 653815 15245556 ~ 15267949 (+)
G1146078 LOC106588898 non-coding upstream 12051 14578526 ~ 14578925 (+)
G1146077 NA non-coding upstream 12571 14578004 ~ 14578405 (+)
G1146072 LOC106588898 non-coding upstream 18332 14572380 ~ 14572644 (+)
G1146060 NA non-coding upstream 33362 14557366 ~ 14557614 (+)
G1146057 NA non-coding upstream 37180 14553487 ~ 14553796 (+)
G1146087 NA non-coding downstream 1044 14592785 ~ 14593140 (+)
G1146120 NA non-coding downstream 78709 14670450 ~ 14670705 (+)
G1146121 NA non-coding downstream 78970 14670711 ~ 14670967 (+)
G1146123 NA non-coding downstream 81469 14673210 ~ 14673541 (+)
G1146124 xylt1 non-coding downstream 81940 14673681 ~ 14674616 (+)
bmerb1 LOC106564575 other upstream 251621 14314608 ~ 14339355 (+)
LOC110485722 NA other upstream 285450 14301288 ~ 14305526 (+)
LOC110485721 LOC106588948 other upstream 292134 14298243 ~ 14299604 (+)
G1145578 LOC106581475 other upstream 313643 14276709 ~ 14277333 (+)
LOC110485710 LOC106589277 other upstream 502398 13962701 ~ 14089440 (+)
LOC110487292 LOC106588691 other downstream 713384 15291490 ~ 15334559 (+)
LOC110485749 LOC106588617 other downstream 834133 15425826 ~ 15432013 (+)
G1146817 LOC106597170 other downstream 845007 15436748 ~ 15438252 (+)

Expression

G1146086 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G1146086 Expression in each Bioproject

Bar chart with 21 bars.
G1146086 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network