G1146703


Basic Information

Item Value
gene id G1146703
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 15187421 ~ 15187897 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1307984
cttttgccacatttcaggcttcaaacataaagatataaaactgtgttttttgtgaagaatcaacaacaagtgggacacaatcatgaagtggaacgacatttattggatatttcaaacttttttaacaaatcaaaaactgaaaaattgggcgtgcaaaattattcagcccctttactttcagtgcagaaaactctctccagaagttcagtgaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgtaatcaagtctccgtataaatgcacctgcactgtgatagtctcagaggtccgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtctgagatactgttgtgaagaagtttaaagccggatttggatacaaaaagatttcccaagctttaaacatcccaaggagcactgtacaagcgataatattg

Function

NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1307984 True 477 lncRNA 0.38 1 15187421 15187897
Loading

Neighbor

gene id symbol gene type direction distance location
LOC118938532 NA coding downstream 45881 15135602 ~ 15141540 (-)
LOC110485736 sec23b coding downstream 276276 14895830 ~ 14911145 (-)
LOC110487289 LOC106588894 coding downstream 295964 14875843 ~ 14891457 (-)
LOC110487291 LOC106564596 coding downstream 343989 14804668 ~ 14843432 (-)
LOC110485733 xylt1 coding downstream 513058 14546527 ~ 14674363 (-)
LOC118938534 LOC106564623 coding upstream 166769 15354666 ~ 15357765 (-)
LOC110485741 LOC106588590 coding upstream 182493 15370390 ~ 15373541 (-)
LOC110485744 LOC106588598 coding upstream 188249 15376146 ~ 15383913 (-)
LOC110485745 LOC106588599 coding upstream 207404 15395301 ~ 15399275 (-)
LOC118938219 LOC106588599 coding upstream 218773 15406670 ~ 15410656 (-)
G1146697 NA non-coding downstream 2987 15184196 ~ 15184434 (-)
G1146676 NA non-coding downstream 26850 15160353 ~ 15160571 (-)
G1146672 NA non-coding downstream 33790 15153335 ~ 15153631 (-)
G1146659 NA non-coding downstream 64241 15122596 ~ 15123180 (-)
G1146657 NA non-coding downstream 69364 15116798 ~ 15118057 (-)
G1146934 NA non-coding upstream 53907 15241804 ~ 15242055 (-)
G1146949 NA non-coding upstream 80606 15268503 ~ 15269517 (-)
G1146960 NA non-coding upstream 102584 15290481 ~ 15290776 (-)
G1146980 LOC106588691 non-coding upstream 139204 15327101 ~ 15364617 (-)
G1146985 LOC106588582 non-coding upstream 155441 15343338 ~ 15343698 (-)
G1146485 NA other downstream 261804 14922610 ~ 14925617 (-)
G1146446 NA other downstream 390149 14796666 ~ 14797272 (-)
G1146251 NA other downstream 475467 14710582 ~ 14711954 (-)
G1145830 LOC103354157 other downstream 1007091 14177247 ~ 14180330 (-)
G1145790 NA other downstream 1096634 14089658 ~ 14090787 (-)
LOC110485748 pdcd11 other upstream 247204 15432063 ~ 15454831 (-)
G1147096 NA other upstream 403417 15591314 ~ 15591714 (-)
G1147218 NA other upstream 491157 15679054 ~ 15679374 (-)
G1147224 NA other upstream 498289 15686186 ~ 15686827 (-)

Expression

G1146703 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G1146703 Expression in each Bioproject

Bar chart with 18 bars.
G1146703 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network