G1150109


Basic Information

Item Value
gene id G1150109
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 18043427 ~ 18044028 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1311630
gttaagaacacattcttatttacaatgacggcctaccataaggcaaaaggcctcctgcggggacgggggctgggataaaaaaatatatgtttttgtcttaggtctctctgtgttgagacaacacaacactacataaagagagacctaaagacaacaacatagcaaggcaacaacacatgacaacgtagcatggtagcaacacaacatggtagcaacacaacatggtagaaacacaacatggtagaaacacaacatggtagcaacacaacatggtagaaacacaacatggtagcaacacaacatggtagcaacacaacatggtagcaacacaacatggtagcaacacaacatggtagcaacacaacatggtagaaacacaacatggtagaaacacaacatggtagaaacacaacatggtagcaacacaacatggtagaaacacaacatggtagcaacacaacatggtagcaacacaacatggtagcaacacaacatggtagcaacacaacatggtagaaacacaacatggtagcaacacaacatggtagcaacacaacatggtagaaacacaacatggtagcaacacaacatggtagaaacac

Function

NR:

description
PREDICTED: cornifin-A-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1311630 True 602 lncRNA 0.42 1 18043427 18044028
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110487300 NA coding upstream 656968 17056420 ~ 17386459 (+)
LOC110485788 LOC106564691 coding upstream 661221 17363341 ~ 17382206 (+)
LOC110485786 NA coding upstream 681215 17355613 ~ 17362212 (+)
LOC110485787 LOC106586800 coding upstream 754239 17266054 ~ 17289188 (+)
LOC118936445 NA coding upstream 987257 16930798 ~ 17056170 (+)
LOC110485792 LOC106586869 coding downstream 25738 18069766 ~ 18076476 (+)
LOC110485794 LOC106586900 coding downstream 78141 18122169 ~ 18124885 (+)
LOC110485795 LOC106586907 coding downstream 88027 18132055 ~ 18169673 (+)
LOC110485098 LOC106564685 coding downstream 130883 18174911 ~ 18202596 (+)
LOC110485796 LOC106586953 coding downstream 159589 18203617 ~ 18218025 (+)
G1150108 NA non-coding upstream 96 18042732 ~ 18043331 (+)
G1150104 NA non-coding upstream 863 18035051 ~ 18042564 (+)
G1150102 NA non-coding upstream 14278 18028276 ~ 18029149 (+)
G1150075 NA non-coding upstream 54256 17988870 ~ 17989171 (+)
G1150011 NA non-coding upstream 100482 17942006 ~ 17942945 (+)
G1150116 NA non-coding downstream 5118 18049146 ~ 18049478 (+)
G1150119 NA non-coding downstream 6836 18050864 ~ 18051271 (+)
G1150120 NA non-coding downstream 7583 18051611 ~ 18056619 (+)
LOC110485799 LOC106586988 non-coding downstream 204245 18236043 ~ 18250838 (+)
G1150206 NA non-coding downstream 209220 18253248 ~ 18256354 (+)
G1148286 NA other upstream 1333316 16708824 ~ 16710111 (+)
G1147590 LOC106586738 other upstream 1735894 16300976 ~ 16307533 (+)
G1147529 NA other upstream 1842800 16199471 ~ 16200627 (+)
LOC110485768 LOC106564707 other upstream 1942077 15965856 ~ 16104020 (+)
G1146820 LOC106588633 other upstream 2601568 15438658 ~ 15441859 (+)
G1150536 NA other downstream 783358 18827386 ~ 18827882 (+)
LOC110485813 LOC106587120 other downstream 808383 18852294 ~ 18855764 (+)
G1151061 LOC106587131 other downstream 853040 18897068 ~ 18920852 (+)

Expression

G1150109 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1150109 Expression in each Bioproject

Bar chart with 20 bars.
G1150109 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network