G1150120



Basic Information


Item Value
gene id G1150120
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 18051611 ~ 18056619 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1311643
tgtcttgtctctgtcctttcccttcaccctgtctccctctgctggtcgttgttatgttaccttttctccccctctttttccccagctgtgccttgtctcctcctaattacccattcaccccgttccccacctgttccctttttccctctgattaggtccctatatctctctctgtttctgctcctgtccttgtcggattcttgtttgtttgtttgtgtttcatgcctgagccagactatcgtcatgtttgctgtaaccttgtcctgtcctgtcggaatctgccggtctatctgagcctacctatgttttgttattaaagaagctctgtttaagttagttcgcttttgggtcctcattc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1311643 True 358 lncRNA 0.47 2 18051611 18056619
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110487300 NA coding upstream 665152 17056420 ~ 17386459 (+)
LOC110485788 LOC106564691 coding upstream 669405 17363341 ~ 17382206 (+)
LOC110485786 NA coding upstream 689399 17355613 ~ 17362212 (+)
LOC110485787 LOC106586800 coding upstream 762423 17266054 ~ 17289188 (+)
LOC118936445 NA coding upstream 995441 16930798 ~ 17056170 (+)
LOC110485792 LOC106586869 coding downstream 13147 18069766 ~ 18076476 (+)
LOC110485794 LOC106586900 coding downstream 65550 18122169 ~ 18124885 (+)
LOC110485795 LOC106586907 coding downstream 75436 18132055 ~ 18169673 (+)
LOC110485098 LOC106564685 coding downstream 118292 18174911 ~ 18202596 (+)
LOC110485796 LOC106586953 coding downstream 146998 18203617 ~ 18218025 (+)
G1150119 NA non-coding upstream 340 18050864 ~ 18051271 (+)
G1150116 NA non-coding upstream 2133 18049146 ~ 18049478 (+)
G1150109 NA non-coding upstream 7583 18043427 ~ 18044028 (+)
G1150108 NA non-coding upstream 8280 18042732 ~ 18043331 (+)
G1150104 NA non-coding upstream 9047 18035051 ~ 18042564 (+)
LOC110485799 LOC106586988 non-coding downstream 191654 18236043 ~ 18250838 (+)
G1150206 NA non-coding downstream 196629 18253248 ~ 18256354 (+)
G1150268 NA non-coding downstream 295149 18351768 ~ 18351976 (+)
G1150274 NA non-coding downstream 310786 18367405 ~ 18372997 (+)
G1150293 NA non-coding downstream 339992 18396611 ~ 18464572 (+)
G1148286 NA other upstream 1341500 16708824 ~ 16710111 (+)
G1147590 LOC106586738 other upstream 1744078 16300976 ~ 16307533 (+)
G1147529 NA other upstream 1850984 16199471 ~ 16200627 (+)
LOC110485768 LOC106564707 other upstream 1950261 15965856 ~ 16104020 (+)
G1146820 LOC106588633 other upstream 2609752 15438658 ~ 15441859 (+)
G1150536 NA other downstream 770767 18827386 ~ 18827882 (+)
LOC110485813 LOC106587120 other downstream 795792 18852294 ~ 18855764 (+)
G1151061 LOC106587131 other downstream 840449 18897068 ~ 18920852 (+)

Expression


G1150120 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1150120 Expression in each Bioproject

Bar chart with 19 bars.
G1150120 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.

Co-expression Network