G1150803



Basic Information


Item Value
gene id G1150803
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 18481196 ~ 18481441 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1312442
gggatatgtctctatcagttttgcacatcgaaagactgaacatttttcccattcctccttgcaaaacagctcgagctcagtgaggtcggatggagagcatttgtgaacagcagttttcagctctttccacagattctcgattggattcaggtctggactttgacttggccattctaacacctggatatgtttatttttgaaccattccattgtagattttgctttatgttttggatcattgtcttg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1312442 True 246 lncRNA 0.41 1 18481196 18481441
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110485801 LOC106587077 coding downstream 13113 18439488 ~ 18468083 (-)
LOC110485802 LOC106587067 coding downstream 51827 18411519 ~ 18429369 (-)
LOC110485803 LOC106587058 coding downstream 69817 18372254 ~ 18411379 (-)
LOC110485800 LOC106587011 coding downstream 134931 18253248 ~ 18346265 (-)
trnar-ccu-47 NA coding downstream 256063 18225061 ~ 18225133 (-)
stx8 LOC106587090 coding upstream 88059 18569500 ~ 18617857 (-)
LOC110485822 LOC106587218 coding upstream 770387 19251828 ~ 19255374 (-)
LOC110485823 LOC106587227 coding upstream 777218 19258659 ~ 19265560 (-)
LOC110485824 LOC106564658 coding upstream 796415 19277856 ~ 19332983 (-)
LOC110485825 LOC106587236 coding upstream 853722 19335163 ~ 19369998 (-)
G1150801 NA non-coding downstream 1335 18479577 ~ 18479861 (-)
G1150774 NA non-coding downstream 53110 18427265 ~ 18428086 (-)
G1150743 NA non-coding downstream 130586 18350367 ~ 18350610 (-)
G1150652 NA non-coding downstream 349649 18131348 ~ 18131547 (-)
G1150651 LOC106604997 non-coding downstream 349994 18130961 ~ 18131202 (-)
G1150808 NA non-coding upstream 5992 18487433 ~ 18487850 (-)
G1150812 NA non-coding upstream 16996 18498437 ~ 18498666 (-)
G1150825 NA non-coding upstream 44567 18526008 ~ 18526242 (-)
G1150827 NA non-coding upstream 48492 18529933 ~ 18530163 (-)
G1150828 NA non-coding upstream 49013 18530454 ~ 18530663 (-)
G1150558 LOC106564720 other downstream 438593 18035160 ~ 18042603 (-)
G1148075 NA other downstream 2002109 16475282 ~ 16479087 (-)
LOC110485776 NA other downstream 2199692 16279894 ~ 16281541 (-)
G1147934 NA other downstream 2382232 16098410 ~ 16098964 (-)
G1147224 NA other downstream 2794369 15686186 ~ 15686827 (-)
G1150824 NA other upstream 42026 18523467 ~ 18523862 (-)
G1150846 NA other upstream 74340 18555781 ~ 18556073 (-)
G1151033 NA other upstream 370786 18852227 ~ 18853377 (-)
G1151819 LOC106587198 other upstream 760472 19241913 ~ 19242479 (-)
G1151820 NA other upstream 761404 19242845 ~ 19243074 (-)

Expression


G1150803 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1150803 Expression in each Bioproject

Bar chart with 17 bars.
G1150803 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network