G1150824



Basic Information


Item Value
gene id G1150824
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 18523467 ~ 18523862 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1312465
atacaatccacctgtgtgtaatcaagtctccgtataaatgcacctgcactgtgatagtctcagaggtccgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagccagatttggatacaaaaagatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctggctgtccctctaaactttcagctcatacaaggagaagactgatcacagatgcagccaagaggcccatgatcactctggatgaactgcagagatctacagctgaggtgggagactctgtccataggacaacaatc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1312465 True 396 TUCP 0.45 1 18523467 18523862
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110485801 LOC106587077 coding downstream 55384 18439488 ~ 18468083 (-)
LOC110485802 LOC106587067 coding downstream 94098 18411519 ~ 18429369 (-)
LOC110485803 LOC106587058 coding downstream 112088 18372254 ~ 18411379 (-)
LOC110485800 LOC106587011 coding downstream 177202 18253248 ~ 18346265 (-)
trnar-ccu-47 NA coding downstream 298334 18225061 ~ 18225133 (-)
stx8 LOC106587090 coding upstream 45638 18569500 ~ 18617857 (-)
LOC110485822 LOC106587218 coding upstream 727966 19251828 ~ 19255374 (-)
LOC110485823 LOC106587227 coding upstream 734797 19258659 ~ 19265560 (-)
LOC110485824 LOC106564658 coding upstream 753994 19277856 ~ 19332983 (-)
LOC110485825 LOC106587236 coding upstream 811301 19335163 ~ 19369998 (-)
G1150812 NA non-coding downstream 24801 18498437 ~ 18498666 (-)
G1150808 NA non-coding downstream 35617 18487433 ~ 18487850 (-)
G1150803 NA non-coding downstream 42026 18481196 ~ 18481441 (-)
G1150801 NA non-coding downstream 43606 18479577 ~ 18479861 (-)
G1150774 NA non-coding downstream 95381 18427265 ~ 18428086 (-)
G1150825 NA non-coding upstream 2146 18526008 ~ 18526242 (-)
G1150827 NA non-coding upstream 6071 18529933 ~ 18530163 (-)
G1150828 NA non-coding upstream 6592 18530454 ~ 18530663 (-)
G1150829 NA non-coding upstream 7945 18531807 ~ 18532015 (-)
G1150832 NA non-coding upstream 12811 18536673 ~ 18537297 (-)
G1150558 LOC106564720 other downstream 480864 18035160 ~ 18042603 (-)
G1148075 NA other downstream 2044380 16475282 ~ 16479087 (-)
LOC110485776 NA other downstream 2241963 16279894 ~ 16281541 (-)
G1147934 NA other downstream 2424503 16098410 ~ 16098964 (-)
G1147224 NA other downstream 2836640 15686186 ~ 15686827 (-)
G1150846 NA other upstream 31919 18555781 ~ 18556073 (-)
G1151033 NA other upstream 328365 18852227 ~ 18853377 (-)
G1151819 LOC106587198 other upstream 718051 19241913 ~ 19242479 (-)
G1151820 NA other upstream 718983 19242845 ~ 19243074 (-)

Expression


G1150824 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G1150824 Expression in each Bioproject

Bar chart with 20 bars.
G1150824 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network