G1150825



Basic Information


Item Value
gene id G1150825
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 18526008 ~ 18526242 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1312466
CCCCCATCCCTCGCCCCAAATGAAGCCAAATAACTCTGTGTCAGTGAGGAGACCCCCCAAACCCCTACCTCACCACAGACTCCCACTGACCCATCTCCACTGACAGAGCTGGATGGGGGTAAGACAGGCCAGGAATGTATGGATCCCTGTTTTTTTCAAATTCTCCTGATTCTGCTCTTAACTTTTACATAGGAGATGTCCCTCCCACATAGCTTAGTGGTTAATTATTCACCAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1312466 True 235 lncRNA 0.49 1 18526008 18526242

Neighbor


gene id symbol gene type direction distance location
LOC110485801 LOC106587077 coding downstream 57925 18439488 ~ 18468083 (-)
LOC110485802 LOC106587067 coding downstream 96639 18411519 ~ 18429369 (-)
LOC110485803 LOC106587058 coding downstream 114629 18372254 ~ 18411379 (-)
LOC110485800 LOC106587011 coding downstream 179743 18253248 ~ 18346265 (-)
trnar-ccu-47 NA coding downstream 300875 18225061 ~ 18225133 (-)
stx8 LOC106587090 coding upstream 43258 18569500 ~ 18617857 (-)
LOC110485822 LOC106587218 coding upstream 725586 19251828 ~ 19255374 (-)
LOC110485823 LOC106587227 coding upstream 732417 19258659 ~ 19265560 (-)
LOC110485824 LOC106564658 coding upstream 751614 19277856 ~ 19332983 (-)
LOC110485825 LOC106587236 coding upstream 808921 19335163 ~ 19369998 (-)
G1150812 NA non-coding downstream 27342 18498437 ~ 18498666 (-)
G1150808 NA non-coding downstream 38158 18487433 ~ 18487850 (-)
G1150803 NA non-coding downstream 44567 18481196 ~ 18481441 (-)
G1150801 NA non-coding downstream 46147 18479577 ~ 18479861 (-)
G1150774 NA non-coding downstream 97922 18427265 ~ 18428086 (-)
G1150827 NA non-coding upstream 3691 18529933 ~ 18530163 (-)
G1150828 NA non-coding upstream 4212 18530454 ~ 18530663 (-)
G1150829 NA non-coding upstream 5565 18531807 ~ 18532015 (-)
G1150832 NA non-coding upstream 10431 18536673 ~ 18537297 (-)
G1150834 NA non-coding upstream 12230 18538472 ~ 18538676 (-)
G1150824 NA other downstream 2146 18523467 ~ 18523862 (-)
G1150558 LOC106564720 other downstream 483405 18035160 ~ 18042603 (-)
G1148075 NA other downstream 2046921 16475282 ~ 16479087 (-)
LOC110485776 NA other downstream 2244504 16279894 ~ 16281541 (-)
G1147934 NA other downstream 2427044 16098410 ~ 16098964 (-)
G1150846 NA other upstream 29539 18555781 ~ 18556073 (-)
G1151033 NA other upstream 325985 18852227 ~ 18853377 (-)
G1151819 LOC106587198 other upstream 715671 19241913 ~ 19242479 (-)
G1151820 NA other upstream 716603 19242845 ~ 19243074 (-)

Expression


G1150825 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G1150825 Expression in each Bioproject

Bar chart with 10 bars.
G1150825 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network