G1150368



Basic Information


Item Value
gene id G1150368
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 18540240 ~ 18540440 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1311937
GAGGAAATCTGACAGCCATTTTGGTTCCAAACCACTGATTAATAAAAAACAGCCAATCAGGATTATCACTCTGATTTAATCATCTAGTAAACACAGTCGCCTGCTCTAGTCTCCTTCTTTCCCACAAAGAAAGAGCTAACGATTCCCAGCAGTCAATGTCAACTAGTACTGTATGCCAGTTTGAATATGATGAGTGTATGC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1311937 True 201 lncRNA 0.40 1 18540240 18540440

Neighbor


gene id symbol gene type direction distance location
LOC110485799 LOC106586988 coding upstream 289403 18236043 ~ 18250838 (+)
LOC110485797 LOC106586973 coding upstream 304706 18225172 ~ 18235534 (+)
LOC118938622 NA coding upstream 315949 18224173 ~ 18224291 (+)
LOC118938572 NA coding upstream 318084 18222015 ~ 18222156 (+)
LOC118938573 NA coding upstream 319417 18220680 ~ 18220823 (+)
LOC110485807 LOC106564674 coding downstream 78636 18619076 ~ 18623922 (+)
cfap52 cfap52 coding downstream 91612 18632052 ~ 18645428 (+)
LOC110485810 LOC106587099 coding downstream 107280 18647720 ~ 18774065 (+)
grb2a LOC107728184 coding downstream 251424 18791864 ~ 18823288 (+)
LOC110485812 LOC106587115 coding downstream 302516 18842956 ~ 18852140 (+)
G1150366 NA non-coding upstream 1446 18538490 ~ 18538794 (+)
G1150362 NA non-coding upstream 6407 18533624 ~ 18533833 (+)
G1150361 NA non-coding upstream 8040 18531983 ~ 18532200 (+)
G1150343 NA non-coding upstream 45103 18494897 ~ 18495137 (+)
G1150336 NA non-coding upstream 66428 18473594 ~ 18473812 (+)
G1150369 NA non-coding downstream 1914 18542354 ~ 18542553 (+)
G1150376 NA non-coding downstream 12749 18553189 ~ 18553455 (+)
G1150378 NA non-coding downstream 16515 18556955 ~ 18557293 (+)
G1150380 NA non-coding downstream 18041 18558481 ~ 18558792 (+)
ntn1a LOC105012279 non-coding downstream 27032 18471857 ~ 18569139 (+)
G1150206 NA other upstream 283886 18253248 ~ 18256354 (+)
G1148286 NA other upstream 1830129 16708824 ~ 16710111 (+)
G1147590 LOC106586738 other upstream 2232707 16300976 ~ 16307533 (+)
G1147529 NA other upstream 2339613 16199471 ~ 16200627 (+)
G1150536 NA other downstream 286946 18827386 ~ 18827882 (+)
LOC110485813 LOC106587120 other downstream 311971 18852294 ~ 18855764 (+)
G1151061 LOC106587131 other downstream 356628 18897068 ~ 18920852 (+)
G1152196 NA other downstream 1512811 20053251 ~ 20072923 (+)
LOC110485866 LOC106587513 other downstream 1637563 20177543 ~ 20183351 (+)

Expression


G1150368 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1150368 Expression in each Bioproject

Bar chart with 12 bars.
G1150368 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 14.
End of interactive chart.

Co-expression Network