G1152160



Basic Information


Item Value
gene id G1152160
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 19953089 ~ 19953306 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1313976
GACACAATAAGAGTTACATTTGAGTATTTTCTAAGTTGGTCTTTCTGAGGGAATACATCTGCAATATACTGCTAACAATGTAATTCGAAAATGAAAAACACTTCTAGAAATGTACGAAGTAGAATTGATCATGTTCTTGCCTTTGACAGTTTAGATCATTCAAATCTAATAACTCAGGGTTGTGGAGGTCACAGTCTCTTATGACGGCTACCAAAGAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1313976 True 218 lncRNA 0.35 1 19953089 19953306
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110485853 LOC106564724 coding downstream 1502 19891752 ~ 19951587 (-)
LOC110485104 LOC106587435 coding downstream 61691 19872030 ~ 19891398 (-)
LOC110485850 LOC106587400 coding downstream 106356 19839590 ~ 19846733 (-)
LOC118938229 LOC104959036 coding downstream 251509 19697097 ~ 19701580 (-)
LOC118938226 LOC105028355 coding downstream 272842 19677056 ~ 19680247 (-)
LOC118938546 NA coding upstream 134067 20087373 ~ 20088947 (-)
LOC110485859 LOC106587453 coding upstream 157737 20111043 ~ 20120903 (-)
LOC100136217 LOC100136217 coding upstream 169336 20122642 ~ 20131526 (-)
LOC110485861 LOC106587481 coding upstream 180791 20134097 ~ 20137740 (-)
LOC110485865 LOC106587502 coding upstream 212953 20166259 ~ 20170031 (-)
G1152072 LOC106587409 non-coding downstream 84319 19798859 ~ 19868770 (-)
G1152088 LOC106564722 non-coding downstream 126965 19793424 ~ 19826124 (-)
G1152098 NA non-coding downstream 127589 19809239 ~ 19825500 (-)
G1152086 NA non-coding downstream 163026 19789752 ~ 19790063 (-)
G1152017 NA non-coding downstream 239286 19693471 ~ 19713803 (-)
G1152264 NA non-coding upstream 16468 19969774 ~ 20017020 (-)
G1152266 NA non-coding upstream 18568 19971874 ~ 19986869 (-)
G1152267 NA non-coding upstream 20346 19973652 ~ 19989274 (-)
G1152277 NA non-coding upstream 36131 19989437 ~ 20062277 (-)
G1152272 NA non-coding upstream 99736 20053042 ~ 20072512 (-)
G1151940 LOC108272819 other downstream 296204 19655774 ~ 19656885 (-)
LOC110485829 NA other downstream 561706 19388990 ~ 19392179 (-)
LOC110485827 LOC106564656 other downstream 566688 19379408 ~ 19387327 (-)
LOC110485824 LOC106564658 other downstream 620106 19277856 ~ 19332983 (-)
G1151820 NA other downstream 710015 19242845 ~ 19243074 (-)
G1152298 NA other upstream 199127 20152433 ~ 20156750 (-)
G1152720 NA other upstream 550204 20503510 ~ 20503766 (-)
krt98 LOC106587813 other upstream 663915 20617221 ~ 20718484 (-)
G1152751 LOC106587793 other upstream 669972 20623278 ~ 20657642 (-)
G1152754 LOC107090753 other upstream 703166 20656472 ~ 20675752 (-)

Expression


G1152160 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1152160 Expression in each Bioproject

Bar chart with 2 bars.
G1152160 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network