G1153260



Basic Information


Item Value
gene id G1153260
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 20821142 ~ 20828539 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1315274
ttgggcgtgcaaaattattcagcccccttaagttaatactttgtagcgccaccttttgctgcgattacagctgtaagtcgcttggggtatgtctctatcagttttgcacatcgagagactgacattttttcccattcctccttgcaaaacagctcgagctcagtgaggttggatggagagcatttgtgaacagcagttttcagttctttccacagattcgcgattggattcaggtctggactttgacttggccattctaacacctggatatgtttatttttgaaccattccattgtagattttgctttatgttttggatcattgtcttgttggaagacaaatctccgtcccagtctcaggtcttttgcagactcc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1315274 True 375 lncRNA 0.43 2 20821142 20828539
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110485902 LOC106588537 coding downstream 1453 20815855 ~ 20819689 (-)
LOC110485900 LOC106587857 coding downstream 6995 20796505 ~ 20814147 (-)
e7 e7 coding downstream 78085 20737885 ~ 20743057 (-)
krt98 LOC106587813 coding downstream 125041 20617221 ~ 20718484 (-)
LOC110487520 LOC106588527 coding downstream 269861 20550059 ~ 20551281 (-)
LOC100136305 igfbp4 coding upstream 11402 20839941 ~ 20859786 (-)
LOC110485908 LOC106587926 coding upstream 94583 20923122 ~ 20928076 (-)
LOC100135869 LOC100135869 coding upstream 112911 20941450 ~ 20943340 (-)
LOC110485910 LOC106587943 coding upstream 115296 20943835 ~ 20947907 (-)
LOC110485911 LOC106587962 coding upstream 123280 20951819 ~ 20964390 (-)
G1153256 NA non-coding downstream 7525 20812947 ~ 20813617 (-)
G1153203 NA non-coding downstream 89111 20731803 ~ 20732031 (-)
G1153201 NA non-coding downstream 91999 20728926 ~ 20729143 (-)
G1153299 NA non-coding upstream 71154 20899693 ~ 20902005 (-)
G1153302 NA non-coding upstream 85156 20913695 ~ 20913924 (-)
G1153247 NA non-coding upstream 92338 20920877 ~ 20923009 (-)
G1153323 NA non-coding upstream 133593 20962132 ~ 20962360 (-)
G1152758 NA other downstream 134341 20674724 ~ 20686801 (-)
G1152754 LOC107090753 other downstream 145390 20656472 ~ 20675752 (-)
G1152751 LOC106587793 other downstream 163500 20623278 ~ 20657642 (-)
G1152720 NA other downstream 317376 20503510 ~ 20503766 (-)
G1153336 NA other upstream 156192 20984731 ~ 20987773 (-)
si:dkey-237i9.8 LOC106588103 other upstream 429881 21247188 ~ 21260739 (-)
LOC110485936 LOC106588110 other upstream 565267 21262691 ~ 21465440 (-)
LOC110485947 LOC106588570 other upstream 1242885 22069722 ~ 22073496 (-)
si:ch211-214c7.4 LOC106588372 other upstream 1634414 22462260 ~ 22502075 (-)

Expression


G1153260 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 60.
End of interactive chart.

G1153260 Expression in each Bioproject

Bar chart with 20 bars.
G1153260 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network