G1157012



Basic Information


Item Value
gene id G1157012
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 24566639 ~ 24566962 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1319476
gaaggttcaccttccaacaggacaataaccctaagcacacagccaagacaatgcaggagtggcttcgggacaagtctctgaatgtccttgaggggcccagccgaagcccggacttgaacccgatcaaacatctctggagagacctgaaaatagctgtgcagcaatgctccccatccaacctgacagagcttgagcggatctgcagagaggaatgggagaaactccccaaatacaggtgtgccaagcttgttgcaacatacccaagaagactcgaggctgtaatcgctgccaaaggtgcttcaacaaagtactgagtaaagagtc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1319476 True 324 TUCP 0.51 1 24566639 24566962
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110486032 LOC106586122 coding downstream 17660 24543462 ~ 24548979 (-)
LOC110486031 LOC106586117 coding downstream 37532 24522069 ~ 24529107 (-)
btbd3a btbd3 coding downstream 84562 24476084 ~ 24482077 (-)
LOC110486029 ndufaf5 coding downstream 102529 24452016 ~ 24464110 (-)
LOC110486026 snrpb2 coding downstream 153120 24403833 ~ 24413519 (-)
LOC100135918 LOC106586139 coding upstream 59185 24626147 ~ 24673336 (-)
LOC110485115 tbce coding upstream 127668 24694630 ~ 24710664 (-)
LOC110486035 LOC106586159 coding upstream 153050 24720012 ~ 24726010 (-)
LOC110486036 LOC106564826 coding upstream 268327 24835289 ~ 24839255 (-)
LOC110486037 mlp3c coding upstream 335223 24902185 ~ 24903303 (-)
G1157009 NA non-coding downstream 1712 24564681 ~ 24564927 (-)
G1157006 NA non-coding downstream 6348 24560079 ~ 24560291 (-)
G1157004 LOC106564832 non-coding downstream 11152 24554907 ~ 24555487 (-)
G1156955 LOC106586048 non-coding downstream 125362 24434312 ~ 24441277 (-)
G1156952 NA non-coding downstream 138467 24427578 ~ 24428172 (-)
G1157014 LOC106586133 non-coding upstream 2793 24569755 ~ 24570037 (-)
G1157015 LOC106586133 non-coding upstream 3476 24570438 ~ 24570676 (-)
G1157016 NA non-coding upstream 4022 24570984 ~ 24571705 (-)
G1157073 NA non-coding upstream 108860 24675822 ~ 24676106 (-)
G1157077 NA non-coding upstream 114168 24681130 ~ 24681350 (-)
G1156864 NA other downstream 266407 24298919 ~ 24300232 (-)
LOC110486013 LOC106585880 other downstream 477647 24086694 ~ 24134220 (-)
LOC110485996 LOC106586353 other downstream 859452 23699036 ~ 23707634 (-)
G1156460 LOC106585723 other downstream 964949 23599507 ~ 23601690 (-)
G1155782 LOC106585672 other downstream 1163007 23402379 ~ 23403632 (-)
G1157522 ifm3 other upstream 504524 25071149 ~ 25103009 (-)
G1157525 NA other upstream 510185 25077147 ~ 25080569 (-)
G1160103 NA other upstream 1381128 25948090 ~ 25951532 (-)
G1160105 NA other upstream 1382510 25949472 ~ 25951268 (-)
G1160215 NA other upstream 1597795 26164757 ~ 26170670 (-)

Expression


G1157012 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G1157012 Expression in each Bioproject

Bar chart with 20 bars.
G1157012 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network