G1157893



Basic Information


Item Value
gene id G1157893
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 25384812 ~ 25385310 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1320474
actgaagagatgcgtcttcagtagagacttaaaggttgagaccgagtttgcgtctctgacatgggtaggcagaccgttccataaaaatggagctctataggagaaagccctgcctccagctgtttgcttagaaattctagggacaattaggaggcctgcgtcttgtgaccgtagcgtacgtgtaggtatgtacggcaggaccaaatcagagagataggtaagagcaagcccatgtaatgctttgtaggttagcagtaaaaccttgaaatcagcccttgctttgacaggaagccagtgtagagaggctagcactggagtaatatgatcaaattttttggttctagtcaggattctagcagccgtatttagctctaactgaagtttatttagtgctttatccgggtagccggaaagtagagcattgcagtagtctaacctagaagtgacaaaagcatggattaatttttctgcatcatttttggacagaaagtttctgatt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1320474 True 499 lncRNA 0.43 1 25384812 25385310
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110486050 NA coding downstream 30317 25353785 ~ 25354495 (-)
LOC110486048 LOC106584975 coding downstream 32660 25340512 ~ 25352152 (-)
LOC110486046 NA coding downstream 192229 25188528 ~ 25192583 (-)
LOC110486043 LOC106586197 coding downstream 243397 25109539 ~ 25141415 (-)
LOC110487524 LOC106586364 coding downstream 363578 25013203 ~ 25021234 (-)
LOC110485116 LOC106564779 coding upstream 72404 25457714 ~ 25468133 (-)
LOC110486055 LOC106564780 coding upstream 84719 25470029 ~ 25476858 (-)
LOC110486059 LOC106586244 coding upstream 243454 25628764 ~ 25663083 (-)
LOC110516915 NA coding upstream 448755 25834065 ~ 25842434 (-)
LOC110516916 NA coding upstream 541612 25926922 ~ 25937198 (-)
G1157891 NA non-coding downstream 3161 25381039 ~ 25381651 (-)
G1157890 NA non-coding downstream 3977 25380565 ~ 25380835 (-)
G1157889 NA non-coding downstream 4551 25379771 ~ 25380261 (-)
G1157888 NA non-coding downstream 5788 25378817 ~ 25379024 (-)
G1157887 LOC106584925 non-coding downstream 8741 25374073 ~ 25376071 (-)
G1157894 NA non-coding upstream 1261 25386571 ~ 25386928 (-)
G1157900 NA non-coding upstream 9186 25394496 ~ 25394699 (-)
G1157909 NA non-coding upstream 20873 25406183 ~ 25406409 (-)
G1157910 NA non-coding upstream 22213 25407523 ~ 25407736 (-)
G1157911 LOC105030512 non-coding upstream 22833 25408143 ~ 25408401 (-)
G1157522 ifm3 other downstream 282226 25071149 ~ 25103009 (-)
G1157525 NA other downstream 304243 25077147 ~ 25080569 (-)
G1157012 NA other downstream 817850 24566639 ~ 24566962 (-)
G1156864 NA other downstream 1084580 24298919 ~ 24300232 (-)
LOC110486013 LOC106585880 other downstream 1295820 24086694 ~ 24134220 (-)
G1160103 NA other upstream 562780 25948090 ~ 25951532 (-)
G1160105 NA other upstream 564162 25949472 ~ 25951268 (-)
G1160215 NA other upstream 779447 26164757 ~ 26170670 (-)
LOC110487367 NA other upstream 1378431 26639356 ~ 26788912 (-)
LOC118938441 NA other upstream 1404435 26783371 ~ 26798125 (-)

Expression


G1157893 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1157893 Expression in each Bioproject

Bar chart with 20 bars.
G1157893 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network