G1161908


Basic Information

Item Value
gene id G1161908
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 29298758 ~ 29299656 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1325076
catttattggatatttcaaacttttttaacaaatcaaaaactgaaaaattgggcgtgcaaaattattcagcccctttactttcagtgcagcaaactctctccagaagttcagtgagggtctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgtaatcaagtctccgtataaatgcacctgcactgtgatagtctcagaggtccgttaaaagcgcagagagcataatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagccggatttggatacaaaaagatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctggccgtccctctaaactttcacctcatacaaggagaagactgatcagagatgcagccaagaggcccatgatcactctggatgaactgcagagatctacagctgaggtgggagactctgtccataggacaacaatcagtcgtatattgcacaaatctggcctttatggaagagtggcaagaagaaagccatttcttaaagatatccattaaaagtgtcgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctctggtcagattaaaccaaaattgaactttttggcaacaatgcaaaacgttatgtttggcgtaaaagcaacacagctgaacacaccatccccactgtcaaacatggcggtggcagcatcatggtttgggcctgcttttcttcagcagggacagagaagatggttaaaattgatgggaagatggatggagccaaatacaggac

Function

NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1325076 True 899 TUCP 0.43 1 29298758 29299656
Loading

Neighbor

gene id symbol gene type direction distance location
rrp36 rrp36 coding upstream 126237 29168401 ~ 29172521 (+)
LOC110486062 LOC106585334 coding upstream 438153 28859535 ~ 28860605 (+)
LOC110485131 LOC106571816 coding upstream 523818 28768216 ~ 28774940 (+)
LOC118938260 LOC106593417 coding upstream 545279 28751512 ~ 28753479 (+)
LOC118938259 LOC106566139 coding upstream 577022 28716818 ~ 28721736 (+)
LOC110486069 klc4 coding downstream 73645 29373301 ~ 29409473 (+)
LOC110486070 hebp1 coding downstream 119707 29419363 ~ 29436445 (+)
LOC110486071 LOC106564807 coding downstream 144467 29444123 ~ 29485813 (+)
LOC110486072 LOC106585018 coding downstream 198406 29498062 ~ 29591905 (+)
LOC110486077 LOC106564801 coding downstream 355900 29655556 ~ 29706148 (+)
G1161898 NA non-coding upstream 6127 29292321 ~ 29292631 (+)
G1161894 NA non-coding upstream 13841 29284634 ~ 29284917 (+)
G1161893 NA non-coding upstream 15642 29282890 ~ 29283116 (+)
G1161837 NA non-coding upstream 100225 29198284 ~ 29198533 (+)
G1161833 NA non-coding upstream 102937 29195616 ~ 29195821 (+)
G1161914 NA non-coding downstream 4619 29304275 ~ 29304501 (+)
G1161915 NA non-coding downstream 5767 29305423 ~ 29305725 (+)
si:ch211-126j24.1 LOC106585260 non-coding downstream 13862 29266618 ~ 29370947 (+)
G1161931 NA non-coding downstream 47573 29347229 ~ 29347532 (+)
G1161933 NA non-coding downstream 48502 29348158 ~ 29348422 (+)
G1159924 NA other upstream 479310 28818734 ~ 28819448 (+)
LOC110513252 NA other upstream 599937 28338501 ~ 28698821 (+)
LOC110487355 LOC106561190 other upstream 799552 28472333 ~ 28500669 (+)
G1159684 NA other upstream 1040784 28252530 ~ 28257974 (+)
G1159631 NA other upstream 1173120 28119665 ~ 28125638 (+)
G1162364 NA other downstream 194706 29494362 ~ 29494902 (+)
G1162753 NA other downstream 531098 29830754 ~ 29831296 (+)
LOC110486104 chchd5 other downstream 1814655 31113781 ~ 31119681 (+)
LOC110486134 LOC106600876 other downstream 2702095 32001741 ~ 32159164 (+)

Expression

G1161908 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1161908 Expression in each Bioproject

Bar chart with 21 bars.
G1161908 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network