G1168629



Basic Information


Item Value
gene id G1168629
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 35097452 ~ 35111011 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1332681
gtcccactccaaactccactatggccaagaccaaagagctgtcaaaggacaccagaaacaaaattgtagacctgcaccaggctgggaaggctgaatctgcaataggtaagcagcttggtttgaagaaatcaactgtgggagcaattattaggaaatggaagacatacaagaccactgataatctccctcgatctggggctccacgcaagatctcaccccgtggggtcaaaatgatcacaagaacggtgagcaaaaatcccagaaccacacggggtgacctagtgaatgacctgcagagagctgggaccaaagtaacaaagcctaccatcagtaacacactacgccgccaggtactcaaatcctgc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1332681 True 365 TUCP 0.49 2 35097452 35111011
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110486196 ubc12 coding downstream 130556 34955716 ~ 34966896 (-)
ndkb ndkb coding downstream 186667 34907936 ~ 34910785 (-)
si:dkey-89b17.4 LOC106607502 coding downstream 217551 34855625 ~ 34879901 (-)
LOC110486193 LOC106607504 coding downstream 361811 34720795 ~ 34735641 (-)
LOC110486190 LOC106600811 coding downstream 381670 34712159 ~ 34715782 (-)
LOC110486203 LOC106607515 coding upstream 12421 35123432 ~ 35148336 (-)
LOC110486204 LOC106607517 coding upstream 59195 35170206 ~ 35182762 (-)
trnac-gca-7 NA coding upstream 371973 35482984 ~ 35483055 (-)
LOC110486206 LOC106607239 coding upstream 386538 35497549 ~ 35532036 (-)
LOC110485156 LOC105007255 coding upstream 423425 35534436 ~ 35536497 (-)
G1168592 NA non-coding downstream 57997 35038690 ~ 35039455 (-)
G1168542 NA non-coding downstream 78414 35017918 ~ 35019038 (-)
G1168577 NA non-coding downstream 98557 34998687 ~ 34998895 (-)
G1168549 NA non-coding downstream 99055 34994954 ~ 34998397 (-)
G1168568 NA non-coding downstream 123808 34973400 ~ 34973644 (-)
G1168758 NA non-coding upstream 192280 35303291 ~ 35303527 (-)
G1168760 NA non-coding upstream 196903 35307914 ~ 35308135 (-)
G1168801 NA non-coding upstream 231526 35342537 ~ 35342759 (-)
G1168828 NA non-coding upstream 244506 35355517 ~ 35369938 (-)
G1168830 NA non-coding upstream 248641 35359652 ~ 35368640 (-)
G1168539 LOC106600802 other downstream 89155 35002513 ~ 35008297 (-)
G1168559 NA other downstream 147143 34949237 ~ 34950309 (-)
G1168448 NA other downstream 245791 34843280 ~ 34851661 (-)
G1170691 rl19 other upstream 751141 35862152 ~ 35864644 (-)
LOC110485158 LOC106607258 other upstream 887912 35995257 ~ 36000992 (-)
G1170811 NA other upstream 979751 36090762 ~ 36091417 (-)
G1170826 NA other upstream 999091 36110102 ~ 36110439 (-)

Expression


G1168629 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1168629 Expression in each Bioproject

Bar chart with 20 bars.
G1168629 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network