G1168832


Basic Information

Item Value
gene id G1168832
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 35372545 ~ 35474347 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1332921
caagtagcacttactgcattatatagacaagtcaatgctattgttagggtaccaattgtgacaggttcggtagggaaaaggccagagttggagatctctggtaaggactacttactgttttggtagagaaaaggccacagtcgtagagctctggtaaagatgacttcctgctaactccatgatttccatcttgtctggagcccattcgtgtaggtggtagtcccccaaggagtctctttaaagtgagtttctaccctgggacgtgctaattttaaatattcggggacactaactgatagctgtgcagttcacggccaagccccttccacacctattgtgaaataactatttgtcttcatgctaatgtgagtaggcagcttatgactgaggtgcttgag
>TU1332919
caagtagcacttactgcattatatagacaagtcaatgctattgttagggtaccaattgtgacaggttcggtagggaaaaggccagagttggagatctctggtaaggactacttactgttttggtagagaaaaggccacagtcgtagagctctggtaaagatgacttcctgctaactccatgatttccatcttgtctggagcccattcgtgtaggtggtagtcccccaaggagtctctttaaagtgagtttctaccctgggacgtgctcattttaaatattcggggacactaactgatagctgtgcagttcacggccaagccccttccacacctattgtgatataactatttgtcttcatgctaatgtgagtaggcagcttatgactgaggtgcttgagcttgatgaggcgtcttccacattgtcagctgatcgttgatgtgaaaaagttgtgtgtgattacatagagacaaagaacacaacacatgaaagcagtttatgtttgctttcttgatactcgagagcagagtctagtggtaaaacacagttatgttaac

Function

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1332921 False 398 lncRNA 0.45 2 35372545 35474347
TU1332919 True 555 lncRNA 0.43 2 35383712 35474347
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110486204 LOC106607517 coding downstream 189783 35170206 ~ 35182762 (-)
LOC110486203 LOC106607515 coding downstream 224209 35123432 ~ 35148336 (-)
LOC110486202 LOC106600799 coding downstream 264915 35076805 ~ 35107630 (-)
LOC110486196 ubc12 coding downstream 405649 34955716 ~ 34966896 (-)
ndkb ndkb coding downstream 461760 34907936 ~ 34910785 (-)
trnac-gca-7 NA coding upstream 8637 35482984 ~ 35483055 (-)
LOC110486206 LOC106607239 coding upstream 23202 35497549 ~ 35532036 (-)
LOC110485156 LOC105007255 coding upstream 60089 35534436 ~ 35536497 (-)
LOC110486209 LOC100196171 coding upstream 62927 35537274 ~ 35547651 (-)
LOC110486210 LOC106600792 coding upstream 76664 35551011 ~ 35556137 (-)
G1168828 NA non-coding downstream 2607 35355517 ~ 35369938 (-)
G1168830 NA non-coding downstream 3905 35359652 ~ 35368640 (-)
G1168801 NA non-coding downstream 29786 35342537 ~ 35342759 (-)
G1168760 NA non-coding downstream 64410 35307914 ~ 35308135 (-)
G1168758 NA non-coding downstream 69018 35303291 ~ 35303527 (-)
G1170534 NA non-coding upstream 50260 35524607 ~ 35525082 (-)
G1170535 NA non-coding upstream 51931 35526278 ~ 35526661 (-)
G1170546 NA non-coding upstream 90163 35564510 ~ 35572006 (-)
LOC110486211 LOC106607244 non-coding upstream 109259 35583606 ~ 35680880 (-)
G1170611 NA non-coding upstream 208628 35682975 ~ 35683256 (-)
G1168629 NA other downstream 261534 35097452 ~ 35111011 (-)
G1168539 LOC106600802 other downstream 364248 35002513 ~ 35008297 (-)
G1168559 NA other downstream 422236 34949237 ~ 34950309 (-)
si:dkey-89b17.4 LOC106607502 other downstream 507149 34855625 ~ 34879901 (-)
G1170691 rl19 other upstream 387805 35862152 ~ 35864644 (-)
LOC110485158 LOC106607258 other upstream 524576 35995257 ~ 36000992 (-)
G1170811 NA other upstream 616415 36090762 ~ 36091417 (-)
G1170826 NA other upstream 635755 36110102 ~ 36110439 (-)
G1170998 NA other upstream 1018742 36493089 ~ 36493524 (-)

Expression

G1168832 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G1168832 Expression in each Bioproject

Bar chart with 4 bars.
G1168832 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.

Co-expression Network