G1170534



Basic Information


Item Value
gene id G1170534
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 35524607 ~ 35525082 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1334879
ctgttattagccaactcttgcgttccgtcagtagattagtgggtttccgtgtggtagaggggatgaatccatatcacacaacaacaacaaaaataaaaacaatagatatagttatagaggcccaagaagaaaaataaattaaaataaaataaaataaaaattgtccgattgtctattcagatagcagccgataagatagccaacggctagcaggccgcagatgggcgcccaggcaacgttgcgccggaggagccagccggacaattccctcgggtagacaacgtcggcagtctagccgtgaaggcccggtggggctccgcgtaggcagcaaaacgggtccggataggtgactgcagcccaggagtgattgatggaactcttcagctggctagctccggaacaattgatgttggctccggaatcgacgaaagccgatagtcacacggatagcagctagctagctgcgagatccaggc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1334879 True 476 lncRNA 0.50 1 35524607 35525082
Loading

Neighbor


gene id symbol gene type direction distance location
trnac-gca-7 NA coding downstream 41552 35482984 ~ 35483055 (-)
LOC110486204 LOC106607517 coding downstream 341845 35170206 ~ 35182762 (-)
LOC110486203 LOC106607515 coding downstream 376271 35123432 ~ 35148336 (-)
LOC110486202 LOC106600799 coding downstream 416977 35076805 ~ 35107630 (-)
LOC110486196 ubc12 coding downstream 557711 34955716 ~ 34966896 (-)
LOC110485156 LOC105007255 coding upstream 9354 35534436 ~ 35536497 (-)
LOC110486209 LOC100196171 coding upstream 12192 35537274 ~ 35547651 (-)
LOC110486210 LOC106600792 coding upstream 25929 35551011 ~ 35556137 (-)
LOC110486212 LOC106607243 coding upstream 40648 35565730 ~ 35582423 (-)
LOC110486211 LOC106607244 coding upstream 60535 35583606 ~ 35680880 (-)
G1168835 NA non-coding downstream 43692 35393076 ~ 35480915 (-)
G1168834 NA non-coding downstream 45900 35381483 ~ 35478707 (-)
G1168832 NA non-coding downstream 50260 35372545 ~ 35474347 (-)
G1168828 NA non-coding downstream 154669 35355517 ~ 35369938 (-)
G1168830 NA non-coding downstream 155967 35359652 ~ 35368640 (-)
G1170535 NA non-coding upstream 1196 35526278 ~ 35526661 (-)
G1170546 NA non-coding upstream 39428 35564510 ~ 35572006 (-)
G1170611 NA non-coding upstream 157893 35682975 ~ 35683256 (-)
G1170612 NA non-coding upstream 158531 35683613 ~ 35683825 (-)
G1168629 NA other downstream 413596 35097452 ~ 35111011 (-)
G1168539 LOC106600802 other downstream 516310 35002513 ~ 35008297 (-)
G1168559 NA other downstream 574298 34949237 ~ 34950309 (-)
si:dkey-89b17.4 LOC106607502 other downstream 659211 34855625 ~ 34879901 (-)
G1170691 rl19 other upstream 337070 35862152 ~ 35864644 (-)
LOC110485158 LOC106607258 other upstream 473841 35995257 ~ 36000992 (-)
G1170811 NA other upstream 565680 36090762 ~ 36091417 (-)
G1170826 NA other upstream 585020 36110102 ~ 36110439 (-)
G1170998 NA other upstream 968007 36493089 ~ 36493524 (-)

Expression


G1170534 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1170534 Expression in each Bioproject

Bar chart with 20 bars.
G1170534 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network