G1170618



Basic Information


Item Value
gene id G1170618
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 35691233 ~ 35691445 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1334971
GCACAGCGTTCATTCTAACCACAGGAAGGAGCGTGCAGTTCAACTGAAGATGAGACGATAGGGAGGACAAGGAGGGCTTATCCTGCTGTTTTCAAAACATGCCCAGGGAGAAGGACCTATCTGGGTGTCATCTCTGTGCCAGTGGAGGATAGGTCACATCTGGACCAGACGCTGGCTCAGGGGGGCGGTGCCCCAAAATCTCTGTGTTATCTC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1334971 True 213 lncRNA 0.54 1 35691233 35691445

Neighbor


gene id symbol gene type direction distance location
LOC110486211 LOC106607244 coding downstream 73995 35583606 ~ 35680880 (-)
LOC110486212 LOC106607243 coding downstream 108810 35565730 ~ 35582423 (-)
LOC110486210 LOC106600792 coding downstream 135096 35551011 ~ 35556137 (-)
LOC110486209 LOC100196171 coding downstream 143582 35537274 ~ 35547651 (-)
LOC110485156 LOC105007255 coding downstream 154736 35534436 ~ 35536497 (-)
lasp1 LOC106607249 coding upstream 54259 35745704 ~ 35787458 (-)
LOC110486215 LOC106607251 coding upstream 98009 35789454 ~ 35805064 (-)
LOC110486217 LOC106600984 coding upstream 122832 35814277 ~ 35819297 (-)
LOC118938069 LOC106607229 coding upstream 131291 35822736 ~ 35825104 (-)
cacnb1 LOC106607253 coding upstream 135297 35826742 ~ 35856636 (-)
G1170617 NA non-coding downstream 921 35690000 ~ 35690312 (-)
G1170616 NA non-coding downstream 1770 35689190 ~ 35689463 (-)
G1170612 NA non-coding downstream 7408 35683613 ~ 35683825 (-)
G1170611 NA non-coding downstream 7977 35682975 ~ 35683256 (-)
G1170625 NA non-coding upstream 7775 35699220 ~ 35699449 (-)
G1170628 NA non-coding upstream 9026 35700471 ~ 35720740 (-)
G1170627 NA non-coding upstream 28258 35719703 ~ 35720143 (-)
G1170578 NA non-coding upstream 52511 35743956 ~ 35745430 (-)
G1170590 NA non-coding upstream 114194 35805639 ~ 35806314 (-)
LOC110486204 LOC106607517 other downstream 508586 35170206 ~ 35182762 (-)
G1168629 NA other downstream 580222 35097452 ~ 35111011 (-)
G1168539 LOC106600802 other downstream 682936 35002513 ~ 35008297 (-)
G1168559 NA other downstream 740924 34949237 ~ 34950309 (-)
si:dkey-89b17.4 LOC106607502 other downstream 825837 34855625 ~ 34879901 (-)
G1170691 rl19 other upstream 170707 35862152 ~ 35864644 (-)
LOC110485158 LOC106607258 other upstream 307478 35995257 ~ 36000992 (-)
G1170811 NA other upstream 399317 36090762 ~ 36091417 (-)
G1170826 NA other upstream 418657 36110102 ~ 36110439 (-)
G1170998 NA other upstream 801644 36493089 ~ 36493524 (-)

Expression


G1170618 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G1170618 Expression in each Bioproject

Bar chart with 10 bars.
G1170618 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.

Co-expression Network