G1174236



Basic Information


Item Value
gene id G1174236
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 40972005 ~ 40972268 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1339085
GTGTTTCCCACCACCCATAGCCCTAGCACTGAGGACCAGAGTCAATATCATACACCGGGTTTAGGTATCTGTTCTTCCAAATATTGTAATCAAATCGACAAGGAAAACACATTTACATTGCGCCAGAATTTGTCTCACATGTTTGACACAATCAACAAGTTCTTTCAATGATTGATTTCTATATCAGGCCGTTGCATACATCCTCCAGCTGCTGTTTGAGTCCAATAATTGATGTGTTGATCTCTTCTTGTTTCAGGACTGCAT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1339085 True 264 lncRNA 0.41 1 40972005 40972268

Neighbor


gene id symbol gene type direction distance location
LOC110486371 LOC106607212 coding upstream 4460 40933887 ~ 40967545 (+)
LOC100136169 LOC106607222 coding upstream 238184 40714193 ~ 40733821 (+)
LOC110486361 NA coding upstream 288824 40681175 ~ 40683181 (+)
LOC110486355 LOC106601061 coding upstream 348143 40622959 ~ 40623862 (+)
LOC118938289 NA coding upstream 352539 40618440 ~ 40619466 (+)
LOC110486372 LOC106607210 coding downstream 3187 40975455 ~ 40989382 (+)
angptl6 LOC106607207 coding downstream 77176 41049444 ~ 41054649 (+)
LOC110486375 LOC106601281 coding downstream 83161 41055429 ~ 41065432 (+)
trip10a LOC106601280 coding downstream 93226 41065494 ~ 41087276 (+)
LOC110486378 LOC106601275 coding downstream 408226 41380494 ~ 41390385 (+)
G1174235 NA non-coding upstream 765 40971007 ~ 40971240 (+)
G1174219 NA non-coding upstream 38976 40932744 ~ 40933029 (+)
G1174203 NA non-coding upstream 75479 40896306 ~ 40896526 (+)
G1174193 NA non-coding upstream 80889 40885714 ~ 40891116 (+)
G1174201 NA non-coding upstream 87364 40884266 ~ 40884641 (+)
G1174241 eif3g non-coding downstream 17319 40989587 ~ 40990177 (+)
G1174249 NA non-coding downstream 34957 41007225 ~ 41007451 (+)
G1174253 NA non-coding downstream 74252 41046520 ~ 41046763 (+)
G1174247 NA non-coding downstream 82406 41054674 ~ 41055079 (+)
G1174211 NA other upstream 65532 40905531 ~ 40906473 (+)
polr3k rpc11 other upstream 616032 40354342 ~ 40357833 (+)
G1173715 LOC106601095 other upstream 815826 40080474 ~ 40200482 (+)
G1172996 NA other upstream 1498226 39473458 ~ 39473779 (+)
LOC110486302 LOC106607335 other upstream 2093626 38876161 ~ 38878379 (+)
G1174245 LOC106607208 other downstream 29615 41001883 ~ 41003024 (+)
G1175164 NA other downstream 567223 41539491 ~ 41540680 (+)
LOC110486395 ccd56 other downstream 801222 41773456 ~ 41777013 (+)
G1175317 LOC106601258 other downstream 822092 41794360 ~ 41794807 (+)

Expression


G1174236 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1174236 Expression in each Bioproject

Bar chart with 15 bars.
G1174236 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network