G1178006



Basic Information


Item Value
gene id G1178006
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 44233630 ~ 44272916 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1343438
tatttagtcagccaccaattgtgcaagttctcccacttaaaaagatgagagaggcctgtaattttcatcataggtacacttcaactatgacagacaaaatgagggaaaaaatccagaaaatcacattgtaggatttttaatgaatttatttgcaaattatggtggaaaataagtatttggtcacctacaaacaagcaagatttctggctctcacagacctgtaacttcttctttaag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1343438 True 237 lncRNA 0.35 2 44233630 44272916
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110485183 LOC106607072 coding downstream 9058 44222533 ~ 44224572 (-)
LOC110486489 LOC106607084 coding downstream 64480 44121355 ~ 44169150 (-)
LOC110486490 NA coding downstream 115387 44116040 ~ 44118663 (-)
tlcd4b LOC106601359 coding downstream 145978 44072439 ~ 44087652 (-)
LOC110486482 cnn1 coding downstream 165929 44053297 ~ 44067701 (-)
LOC110486496 LOC106607078 coding upstream 22660 44295576 ~ 44311575 (-)
LOC110486497 LOC106601353 coding upstream 47085 44320001 ~ 44342927 (-)
LOC110486499 syfa coding upstream 87498 44360414 ~ 44370469 (-)
LOC110486500 LOC106601349 coding upstream 104525 44377441 ~ 44397427 (-)
LOC110486501 LOC106607073 coding upstream 126161 44399077 ~ 44413719 (-)
G1178005 NA non-coding downstream 599 44232781 ~ 44233031 (-)
G1178001 NA non-coding downstream 7097 44226060 ~ 44226533 (-)
G1177994 NA non-coding downstream 18545 44214374 ~ 44215085 (-)
G1177981 NA non-coding downstream 22717 44210587 ~ 44210913 (-)
G1177988 NA non-coding downstream 26954 44206459 ~ 44206676 (-)
G1178030 NA non-coding upstream 145 44273061 ~ 44273273 (-)
G1178035 NA non-coding upstream 5454 44278370 ~ 44278812 (-)
G1178039 NA non-coding upstream 10594 44283510 ~ 44283713 (-)
G1178224 NA non-coding upstream 70503 44343419 ~ 44343661 (-)
G1178229 NA non-coding upstream 78381 44351297 ~ 44352694 (-)
epor LOC106601362 other downstream 204645 44024053 ~ 44029014 (-)
zgc:158403 LOC106601368 other downstream 250063 43977147 ~ 43992248 (-)
G1177709 LOC106601291 other downstream 259573 43973539 ~ 43974057 (-)
G1177552 NA other downstream 617622 43601363 ~ 43647736 (-)
G1177238 LOC106607096 other downstream 818527 43414159 ~ 43415103 (-)
G1178281 NA other upstream 190038 44462954 ~ 44463226 (-)
LOC110485184 LOC106601341 other upstream 210706 44467268 ~ 44545484 (-)
G1178286 LOC106607023 other upstream 240520 44513436 ~ 44530531 (-)
G1178763 LOC106607027 other upstream 380156 44653072 ~ 44653468 (-)
G1178765 LOC100380669 other upstream 455660 44725639 ~ 44731351 (-)

Expression


G1178006 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G1178006 Expression in each Bioproject

Bar chart with 19 bars.
G1178006 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network