G1181941



Basic Information


Item Value
gene id G1181941
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 47732130 ~ 47732387 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1347891
ATCTAACAAGTATGACAGTAATGCTGTCTTGCTTGTCCAGTTAATGCTTAATAGTTACAGTATAATGATTCATTCTTCCTGTACAGGTTAGCCTGCAAAGAATAGCCATTGTATTAGCCCATGCTTTTCATGCTCCTAATTAAAGTGCATATCTCTATAAGTTCCTTTGCATTGTTTCCCATTGTCTTCCATTACTTTTACATTCATGGTTTTTCTTCCTTTCTGATTCAAGACTAGTTTGATTGACCAATTCTTGAA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1347891 True 258 lncRNA 0.34 1 47732130 47732387
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110486595 paqrb coding upstream 226141 47482238 ~ 47505989 (+)
tmem100a LOC106606948 coding upstream 260925 47468012 ~ 47471205 (+)
LOC110486592 LOC106606958 coding upstream 321808 47403774 ~ 47410322 (+)
LOC110486591 LOC106606947 coding upstream 331370 47395330 ~ 47400760 (+)
LOC118938083 NA coding upstream 909152 46818538 ~ 46822978 (+)
LOC110486605 tmem220 coding downstream 98534 47830848 ~ 47832931 (+)
LOC110486603 LOC106606941 coding downstream 100847 47833234 ~ 47836337 (+)
LOC110485199 NA coding downstream 115025 47847412 ~ 47858242 (+)
LOC110486607 LOC106601502 coding downstream 143019 47875406 ~ 47912448 (+)
LOC110486609 LOC106601450 coding downstream 194660 47927047 ~ 47932749 (+)
G1181927 NA non-coding upstream 6957 47724824 ~ 47725173 (+)
G1181774 NA non-coding upstream 28963 47601655 ~ 47703167 (+)
G1181660 NA non-coding upstream 133894 47598070 ~ 47598236 (+)
G1181650 NA non-coding upstream 165014 47565031 ~ 47567116 (+)
G1181645 NA non-coding upstream 174277 47557654 ~ 47557853 (+)
G1182094 LOC106601460 non-coding downstream 267211 47999598 ~ 48003504 (+)
G1182107 NA non-coding downstream 292797 48025184 ~ 48025774 (+)
G1182110 NA non-coding downstream 299791 48032178 ~ 48032404 (+)
LOC110486620 LOC106601507 non-coding downstream 360621 48093008 ~ 48102030 (+)
G1181636 NA other upstream 182582 47549279 ~ 47549548 (+)
G1181472 NA other upstream 357653 47374163 ~ 47374477 (+)
LOC110485193 LOC106601421 other upstream 1395852 46302751 ~ 46336386 (+)
G1180047 NA other upstream 1458529 46239144 ~ 46273601 (+)
G1181955 NA other downstream 9974 47742361 ~ 47743064 (+)
G1182153 NA other downstream 387226 48119613 ~ 48122575 (+)
G1182354 LOC106601550 other downstream 823627 48556014 ~ 48561624 (+)
G1182541 NA other downstream 1214362 48946749 ~ 48947969 (+)
G1182555 NA other downstream 1245613 48978000 ~ 48981403 (+)

Expression


G1181941 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1181941 Expression in each Bioproject

Bar chart with 6 bars.
G1181941 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network