G1183337



Basic Information


Item Value
gene id G1183337
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 48667788 ~ 48668082 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1349502
ctcaggagactgaaaagatttggcatgggtcctcagatcttcaaaaggttttacagctacatcctcgagagcatcctgacgggttgcatcactgcctggtatggcagctgctcggcctctgaccgcaaggcactacagagggtagtgcgtacagcccagtacatcaccgaggccaagcttcttgccatccaggacctctataccaagcgatgtcagaggaagggcctaaaattgtcaaagactccagccaccctagtcatagactgttctctctgccatcgcacggcaagtggta

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1349502 True 295 TUCP 0.53 1 48667788 48668082

Neighbor


gene id symbol gene type direction distance location
LOC110485203 ppfia3 coding downstream 2199 48623806 ~ 48665589 (-)
LOC110486646 LOC106601550 coding downstream 95723 48544179 ~ 48572065 (-)
LOC110486643 LOC106606926 coding downstream 137793 48522069 ~ 48529995 (-)
LOC110486641 bcat1 coding downstream 152878 48506263 ~ 48514910 (-)
LOC110486634 LOC106601558 coding downstream 192067 48451625 ~ 48475721 (-)
LOC110486648 nucb1 coding upstream 2149 48670231 ~ 48683477 (-)
LOC110487552 LOC106601568 coding upstream 15900 48683982 ~ 48686124 (-)
LOC110486649 LOC106606880 coding upstream 20946 48689028 ~ 48697978 (-)
LOC110486651 LOC106601513 coding upstream 37631 48705713 ~ 48724776 (-)
LOC110486652 LOC106606918 coding upstream 63057 48731139 ~ 48739071 (-)
G1183330 NA non-coding downstream 11036 48656351 ~ 48656752 (-)
G1183319 NA non-coding downstream 45032 48622211 ~ 48622756 (-)
G1183318 LOC106601548 non-coding downstream 46184 48619001 ~ 48621604 (-)
G1183224 NA non-coding downstream 148081 48516721 ~ 48519707 (-)
G1183222 rpl27 non-coding downstream 169191 48496708 ~ 48498597 (-)
G1183353 NA non-coding upstream 57520 48725602 ~ 48725877 (-)
G1183354 NA non-coding upstream 57910 48725992 ~ 48726228 (-)
G1183357 NA non-coding upstream 61625 48729707 ~ 48730020 (-)
G1183361 NA non-coding upstream 72235 48740317 ~ 48740531 (-)
G1183362 NA non-coding upstream 73156 48741238 ~ 48741469 (-)
G1183225 NA other downstream 196805 48435826 ~ 48470983 (-)
G1183196 NA other downstream 278070 48379267 ~ 48389718 (-)
G1183192 NA other downstream 290822 48364056 ~ 48376966 (-)
G1183190 NA other downstream 302688 48361598 ~ 48365100 (-)
G1183126 NA other downstream 407799 48259524 ~ 48259989 (-)
LOC110486656 syt3 other upstream 229597 48875671 ~ 48936482 (-)
LOC110485205 LOC106597701 other upstream 305101 48959315 ~ 49053966 (-)
setd1a LOC106585476 other upstream 688296 49346540 ~ 49361234 (-)
LOC110486687 LOC106601611 other upstream 818844 49486817 ~ 49504819 (-)
LOC118938314 NA other upstream 869117 49537199 ~ 49544276 (-)

Expression


G1183337 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1183337 Expression in each Bioproject

Bar chart with 19 bars.
G1183337 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network