G1183515



Basic Information


Item Value
gene id G1183515
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 49143255 ~ 49144184 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1349746
TAATGTAACAGTGTGGACGCTAGGTGTAATGTAACAGTGTGGATGCTAGGTGTAATGTAACAGTGTGGACGCTAGGTGTAATGTAACAGTGTGGATGCTAGGTGTAATGTAACAGTGTGGACGCTAGGTGTAATGTAACAGTGTGGATGCTAGGTGTAATGTAACAGTGTGGATGCTAGGTGTAATGTAACAGTGTGGACGCTCGGTGTAGCAAATGTCTCCCATTTGGAAATAACTCTGGACCATGCCAATGT

Function


GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU1349746 True 254 lncRNA 0.44 2 49143255 49144184

Neighbor


gene id symbol gene type direction distance location
LOC110486665 LOC106601588 coding downstream 12298 49114958 ~ 49130957 (-)
LOC110486661 LOC106606886 coding downstream 29997 49104102 ~ 49113258 (-)
LOC110486660 LOC103034594 coding downstream 46934 49081433 ~ 49096321 (-)
LOC110487553 NA coding downstream 62233 49079125 ~ 49081022 (-)
LOC110486659 LOC106601577 coding downstream 65087 49065331 ~ 49078168 (-)
LOC110486668 armc5 coding upstream 58862 49203046 ~ 49209637 (-)
LOC110486673 elob coding upstream 71574 49215758 ~ 49219547 (-)
LOC110486672 LOC106606893 coding upstream 76864 49221048 ~ 49225262 (-)
rusf1 cssa06h16orf58 coding upstream 107443 49251627 ~ 49263335 (-)
prr14 LOC106601590 coding upstream 123424 49267608 ~ 49277799 (-)
G1183493 NA non-coding downstream 41371 49099736 ~ 49101884 (-)
G1183473 NA non-coding downstream 98482 49044511 ~ 49044773 (-)
G1183470 NA non-coding downstream 115089 49027962 ~ 49028166 (-)
G1183469 NA non-coding downstream 115353 49027596 ~ 49027902 (-)
G1183512 NA non-coding upstream 24502 49168686 ~ 49169344 (-)
G1183273 NA non-coding upstream 150992 49295176 ~ 49299864 (-)
G1183567 NA non-coding upstream 173098 49317282 ~ 49317483 (-)
G1183297 NA non-coding upstream 180843 49325027 ~ 49325527 (-)
G1183588 NA non-coding upstream 288753 49432937 ~ 49433171 (-)
LOC110485205 LOC106597701 other downstream 165847 48959315 ~ 49053966 (-)
LOC110486656 syt3 other downstream 206798 48875671 ~ 48936482 (-)
G1183337 NA other downstream 475173 48667788 ~ 48668082 (-)
G1183225 NA other downstream 672272 48435826 ~ 48470983 (-)
G1183196 NA other downstream 753537 48379267 ~ 48389718 (-)
setd1a LOC106585476 other upstream 212194 49346540 ~ 49361234 (-)
LOC110486687 LOC106601611 other upstream 342742 49486817 ~ 49504819 (-)
LOC118938314 NA other upstream 393015 49537199 ~ 49544276 (-)
G1183706 NA other upstream 541154 49685338 ~ 49688456 (-)
LOC110486698 LOC106601594 other upstream 691479 49831067 ~ 49853671 (-)

Expression


G1183515 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1183515 Expression in each Bioproject

Bar chart with 9 bars.
G1183515 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network