G1185347



Basic Information


Item Value
gene id G1185347
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 51289810 ~ 51290250 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1351777
CCTCAGTAGGCGAGATGATCGGATCCCCGCTCTTTCTCCCAGCTCCTCCAACGATCTGCTCCTGCTCCGCATCAGATGACCCAGCTTGGTACCTTTAAGAGGAAAAGGTGCTTGTCTAAGCCCAAACAGCCCGCTCTTCTCATCAATATGTAGGCTGTTTCGACCCAGCTAGAACAGTCTCTGTACAACAATCTCTGGGCTGCTTGGAGCCGGAAAGCCATGATCCTAGAGGAAATGTCCAC

Function


NR:

description
pol-like protein

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1351777 True 242 lncRNA 0.52 2 51289810 51290250
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110486733 LOC106606838 coding upstream 296968 50991494 ~ 50992842 (+)
LOC110485209 LOC105013079 coding upstream 324593 50939574 ~ 50965217 (+)
LOC110486729 light coding upstream 395331 50885729 ~ 50894479 (+)
dnm2a NA coding upstream 413508 50832804 ~ 50876302 (+)
LOC110486723 LOC106601660 coding upstream 569991 50715377 ~ 50719819 (+)
LOC110486735 LOC100380774 coding downstream 54128 51344378 ~ 51373991 (+)
LOC110487554 LOC106601638 coding downstream 101610 51384172 ~ 51394113 (+)
LOC110486737 LOC106606772 coding downstream 104186 51394436 ~ 51404580 (+)
LOC110486745 LOC106601712 coding downstream 272114 51562364 ~ 51566331 (+)
LOC110486751 LOC106606781 coding downstream 295996 51586246 ~ 51590496 (+)
G1185343 NA non-coding upstream 3576 51285958 ~ 51286234 (+)
G1185342 NA non-coding upstream 3961 51285630 ~ 51285849 (+)
G1185327 NA non-coding upstream 18096 51271479 ~ 51271714 (+)
G1185323 NA non-coding upstream 20727 51268707 ~ 51269083 (+)
G1185320 NA non-coding upstream 22958 51266509 ~ 51266852 (+)
G1185366 NA non-coding downstream 23516 51313766 ~ 51313985 (+)
G1185435 NA non-coding downstream 152667 51442917 ~ 51471830 (+)
G1185451 NA non-coding downstream 175093 51465343 ~ 51468001 (+)
G1185457 NA non-coding downstream 186085 51476335 ~ 51481810 (+)
G1184435 LOC106606845 other upstream 303244 50985813 ~ 50986566 (+)
G1183875 NA other upstream 1406375 49882821 ~ 49883435 (+)
G1183819 NA other upstream 1454796 49832221 ~ 49835014 (+)
ndua4 ndua4 other upstream 1705248 49580324 ~ 49584562 (+)
G1182742 NA other upstream 1863587 49419570 ~ 49426223 (+)
G1185436 NA other downstream 155657 51445907 ~ 51446557 (+)
G1185521 NA other downstream 337432 51627682 ~ 51628676 (+)
G1185527 NA other downstream 361363 51651613 ~ 51653770 (+)
G1185522 NA other downstream 403633 51693883 ~ 51695058 (+)

Expression


G1185347 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1185347 Expression in each Bioproject

Bar chart with 6 bars.
G1185347 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.

Co-expression Network