G1185900



Basic Information


Item Value
gene id G1185900
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 52350048 ~ 52359478 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1352413
cacacagacctacaccacaacacacacacagaccacctacaccacatcacaacgaccacctacaccacatcacacagaccacctacaccacacacatacctacaccacaacacacacagaccacttacaccacacacacagaccacctacaccacaacacacacagacctacaccacaccacacacacagaccacctaccccacaacacacacacagaccacctaccacacaacacacacagacc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1352413 True 245 lncRNA 0.52 4 52350048 52359478
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110486765 LOC106606792 coding upstream 207318 52141273 ~ 52142730 (+)
LOC110486764 LOC106606789 coding upstream 210549 52121483 ~ 52139499 (+)
LOC110485215 LOC106606764 coding upstream 258365 52014531 ~ 52091683 (+)
LOC110486763 NA coding upstream 395189 51952116 ~ 51954859 (+)
LOC110486748 NA coding upstream 409008 51779397 ~ 51941040 (+)
LOC110486767 alkb7 coding downstream 15346 52374824 ~ 52390015 (+)
LOC110485217 fcl coding downstream 46699 52406177 ~ 52414576 (+)
LOC118938557 LOC106601687 coding downstream 84511 52443989 ~ 52444998 (+)
LOC110486773 LOC106601688 coding downstream 93316 52452794 ~ 52612169 (+)
LOC110486772 NA coding downstream 252770 52612244 ~ 52616224 (+)
G1185898 NA non-coding upstream 3147 52346113 ~ 52346901 (+)
G1185841 NA non-coding upstream 91847 52257351 ~ 52258201 (+)
G1185788 NA non-coding upstream 103510 52244813 ~ 52246538 (+)
G1185835 NA non-coding upstream 115206 52233787 ~ 52234842 (+)
G1185817 NA non-coding upstream 165878 52178177 ~ 52184170 (+)
G1185887 NA non-coding downstream 43544 52403022 ~ 52403680 (+)
G1185940 NA non-coding downstream 125001 52484479 ~ 52485136 (+)
G1185921 NA non-coding downstream 258216 52617694 ~ 52621551 (+)
G1185815 NA other upstream 173543 52175266 ~ 52176505 (+)
G1185528 NA other upstream 384558 51963423 ~ 51965490 (+)
G1185525 NA other upstream 450332 51898956 ~ 51899716 (+)
LOC110539012 LOC106606743 other downstream 644574 52907896 ~ 53046938 (+)
LOC110538743 LOC106601732 other downstream 1086945 53445335 ~ 53450473 (+)
G1187452 NA other downstream 1829089 54188567 ~ 54198015 (+)
G1187390 NA other downstream 1904588 54264066 ~ 54265028 (+)

Expression


G1185900 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 400.
End of interactive chart.

G1185900 Expression in each Bioproject

Bar chart with 7 bars.
G1185900 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 4000.
End of interactive chart.

Co-expression Network