G1189670



Basic Information


Item Value
gene id G1189670
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 56702828 ~ 56752737 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1356902
tgtgttatagtatcaccaggatgtgaactactgtaacatttcagtgtgttatagtgtcaccaggatgtgaactactgtaacagttcagtgtgttatagtgtcaccaggatgtgaactactgtaacagttcagtgtgttatagtgtcaccaggatgtgaactactgtaacagttcagtgtgttattgtgtctcttacaaagacatgaaatactgtaacagttccgtgtgttattatgtctgtaggaggtgaactactgtaacagttcagtgtgtcatattgtctctctctaggaggtgaactactgtaacagttcagtgtgtcattgtgtctcaaggaggtgaactactgtaacagttcagtgtgttatagtgtctctaggaggtgaactactgtaacagttcagtgtgtaatgttgtctctcactaagacgagaaatactgtatcagttcagtgtgttattgtgtctcaaggaggtgaactactgtaacaggacAGTGTACGGTTGtttctcaaggaggtgaactactgtaacagttcagtgtgttatagtgtctctaggaggtgacctactgtaacagttcagtgttttatagtgtctctagaaggtgaactactgtaaaagttcagtgtgttatagtgtctctaggatgtgaactactgtaacagttcagtgtgttatagtgtctctaggaggtgaactactgtaacagttcagtgtgttatagtgtctctaggaggtgaactactgtaacagttcagtgtgttatagtgtctctaggaggtgaactactgtaacagttcagtgtgttatagtgtctctaggaggtgaactactgtaacagttcagtgtgttatagtgtctct
>TU1356903
tgtgttatagtatcaccaggatgtgaactactgtaacatttcagtgtgttatagtgtcaccaggatgtgaactactgtaacagttcagtgtgttatagtgtcaccaggatgtgaactactgtaacagttcagtgtgttatagtgtcaccaggatgtgaactactgtaacagttcagtgtgttattgtgtctcttacaaagacatgaaatactgtaacagttccgtgtgttattatgtctgtaggaggtgaactactgtagcagttcagtgtgtcatagtgtctctctctaggaggtgacctactgtaacagttc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1356902 False 865 lncRNA 0.40 4 56702828 56722853
TU1356903 True 314 lncRNA 0.40 2 56702828 56752737
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118938096 NA coding upstream 22964 56678602 ~ 56679864 (+)
LOC110538765 LOC105013005 coding upstream 28513 56596621 ~ 56674315 (+)
LOC110486855 bri3 coding upstream 581383 56114163 ~ 56121445 (+)
LOC110485236 LOC106606588 coding upstream 614635 56035640 ~ 56088193 (+)
LOC110538766 LOC105013005 coding upstream 786924 55834111 ~ 55915904 (+)
LOC110486865 NA coding downstream 207861 56960598 ~ 56963017 (+)
LOC110517037 drc3 coding downstream 255263 57008000 ~ 57019247 (+)
LOC110516169 LOC106601817 coding downstream 266965 57019702 ~ 57027741 (+)
LOC110486862 LOC106606647 coding downstream 296195 57048932 ~ 57053449 (+)
LOC110486876 rn151 coding downstream 333111 57085848 ~ 57089925 (+)
G1189668 NA non-coding upstream 19946 56682476 ~ 56682882 (+)
G1189607 NA non-coding upstream 39558 56662668 ~ 56663270 (+)
G1189598 NA non-coding upstream 52716 56648573 ~ 56650112 (+)
G1189499 NA non-coding upstream 208542 56493805 ~ 56494286 (+)
G1189487 NA non-coding upstream 259771 56442733 ~ 56443057 (+)
G1189697 NA non-coding downstream 4977 56757714 ~ 56761946 (+)
G1189701 NA non-coding downstream 12699 56765436 ~ 56785201 (+)
G1189702 NA non-coding downstream 14308 56767045 ~ 56768348 (+)
G1189707 NA non-coding downstream 33478 56786215 ~ 56788399 (+)
G1189711 NA non-coding downstream 40820 56793557 ~ 56798251 (+)
G1189040 NA other upstream 763471 55938472 ~ 55939357 (+)
LOC110539040 LOC106601832 other upstream 1336512 55340702 ~ 55394765 (+)
G1188386 NA other upstream 1580209 55121261 ~ 55122619 (+)
G1188344 NA other upstream 1705533 54993674 ~ 54997295 (+)
axin2 LOC105026129 other upstream 2402515 54272638 ~ 54300365 (+)
G1189738 NA other downstream 83679 56836416 ~ 56836996 (+)
G1189675 srebf1 other downstream 125191 56877928 ~ 56925607 (+)
G1189819 NA other downstream 301716 57054453 ~ 57055617 (+)
LOC110514101 LOC106606600 other downstream 843283 57522756 ~ 57640558 (+)
LOC110486909 LOC106601794 other downstream 870936 57613961 ~ 57625405 (+)

Expression


G1189670 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1189670 Expression in each Bioproject

Bar chart with 8 bars.
G1189670 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.

Co-expression Network