G1192815


Basic Information

Item Value
gene id G1192815
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 60641675 ~ 60642185 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1360820
CCGATGCAGGCCTCCACACATACCATCCACATACAAGCCGCCGATGCAGGCCTCCACACATACCATCCACATACAAGGCGCCGATGCAGGCCTCCACACATACCATCCACATACAAGCCGCCGATGCAGGCCTCCACACATACCATCCACATACAAGGCGCCGATGCAGGCCTCCACACATACCATCCACATACAAGGCGCCGATGCAGGCCTCCACACATACCATCCACATACAAGCCACCGATGCAGGCCTCCACACATACCATCCACATACAAGGCGCCGATGCAGGCCTCCACACATACCATCCACATACAAGCCGCCGATGCAGGCCTCCACACATACCATCCACATACAAGCCACCGATGCAGGCCTCCACACATACCATCCACATACAAGCCACCGATGCAGGCCTCCACACATACCATCCACATACAAGGCGCCGATGCAGGCCTCCACACATACCATCCACATACAAGCCGCCGATGCAGGCCTCCACACATACCATCCACA

Function

NR:

description
uncharacterized protein LOC110520487 isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1360820 True 511 TUCP 0.57 1 60641675 60642185

Neighbor

gene id symbol gene type direction distance location
LOC110486976 LOC106606471 coding downstream 75741 60460043 ~ 60565934 (-)
LOC110486979 LOC106606406 coding downstream 232955 60403617 ~ 60408720 (-)
LOC118936527 LOC106606405 coding downstream 254714 60377853 ~ 60386961 (-)
LOC110486987 cyp2k4 coding downstream 303248 60274725 ~ 60367022 (-)
LOC110486988 LOC106606456 coding downstream 378846 60260720 ~ 60262829 (-)
LOC110538808 LOC106601873 coding upstream 364641 61005929 ~ 61026251 (-)
LOC110486965 LOC100135781 coding upstream 904080 61546265 ~ 61550711 (-)
LOC110512085 LOC106601929 coding upstream 1304467 61946652 ~ 62016705 (-)
LOC110487040 LOC106606439 coding upstream 1377520 62019705 ~ 62025559 (-)
LOC110487033 LOC106606440 coding upstream 1388491 62030676 ~ 62064793 (-)
G1192800 NA non-coding downstream 12220 60627769 ~ 60629455 (-)
G1192789 NA non-coding downstream 18083 60623292 ~ 60623592 (-)
G1192785 NA non-coding downstream 22467 60618658 ~ 60619208 (-)
G1192779 NA non-coding downstream 28202 60613155 ~ 60613473 (-)
G1192762 NA non-coding downstream 49539 60591836 ~ 60592136 (-)
G1192817 NA non-coding upstream 725 60642910 ~ 60643112 (-)
G1192818 NA non-coding upstream 1058 60643243 ~ 60643499 (-)
G1192819 NA non-coding upstream 1680 60643865 ~ 60644079 (-)
G1192939 NA non-coding upstream 18093 60660278 ~ 60660812 (-)
G1192941 NA non-coding upstream 25974 60668159 ~ 60668395 (-)
G1192757 NA other downstream 66478 60572370 ~ 60575197 (-)
G1192535 NA other downstream 327121 60219166 ~ 60314554 (-)
G1192519 NA other downstream 433405 60205782 ~ 60208270 (-)
G1193386 NA other upstream 633560 61275745 ~ 61277658 (-)
G1193568 NA other upstream 942589 61584774 ~ 61585260 (-)
G1194074 NA other upstream 1427924 62070109 ~ 62070835 (-)

Expression

G1192815 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G1192815 Expression in each Bioproject

Bar chart with 9 bars.
G1192815 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network