G1192818



Basic Information


Item Value
gene id G1192818
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 60643243 ~ 60643499 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1360823
GTATGTATGCGTCTTCATGACTGTGACCTGTTTACGTTTGCACAGTACAGCATCTAAGTGTTTCTCCTTCCTATGTGGATTCATGTTGGTGGATCTATATGCTTAGTGTGTATGTGCCACCTATCAAACATAAAATACCCTGTATTTGTAGAATCAAGAGCAAAAGGAAGTAGAGGCCCACTCCACGGTGAAATAACTGCCATGCCAGCTTAGCCCAGTTCATTTCCCTATTCTCTAGCGGTATACAACATCTGTAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1360823 True 257 lncRNA 0.42 1 60643243 60643499
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110486976 LOC106606471 coding downstream 77309 60460043 ~ 60565934 (-)
LOC110486979 LOC106606406 coding downstream 234523 60403617 ~ 60408720 (-)
LOC118936527 LOC106606405 coding downstream 256282 60377853 ~ 60386961 (-)
LOC110486987 cyp2k4 coding downstream 304816 60274725 ~ 60367022 (-)
LOC110486988 LOC106606456 coding downstream 380414 60260720 ~ 60262829 (-)
LOC110538808 LOC106601873 coding upstream 363327 61005929 ~ 61026251 (-)
LOC110486965 LOC100135781 coding upstream 902766 61546265 ~ 61550711 (-)
LOC110512085 LOC106601929 coding upstream 1303153 61946652 ~ 62016705 (-)
LOC110487040 LOC106606439 coding upstream 1376206 62019705 ~ 62025559 (-)
LOC110487033 LOC106606440 coding upstream 1387177 62030676 ~ 62064793 (-)
G1192817 NA non-coding downstream 131 60642910 ~ 60643112 (-)
G1192800 NA non-coding downstream 13788 60627769 ~ 60629455 (-)
G1192789 NA non-coding downstream 19651 60623292 ~ 60623592 (-)
G1192785 NA non-coding downstream 24035 60618658 ~ 60619208 (-)
G1192779 NA non-coding downstream 29770 60613155 ~ 60613473 (-)
G1192819 NA non-coding upstream 366 60643865 ~ 60644079 (-)
G1192939 NA non-coding upstream 16779 60660278 ~ 60660812 (-)
G1192941 NA non-coding upstream 24660 60668159 ~ 60668395 (-)
G1192945 NA non-coding upstream 29828 60673327 ~ 60673874 (-)
G1192956 NA non-coding upstream 51384 60694883 ~ 60731907 (-)
G1192815 NA other downstream 1058 60641675 ~ 60642185 (-)
G1192757 NA other downstream 68046 60572370 ~ 60575197 (-)
G1192535 NA other downstream 328689 60219166 ~ 60314554 (-)
G1193386 NA other upstream 632246 61275745 ~ 61277658 (-)
G1193568 NA other upstream 941275 61584774 ~ 61585260 (-)
G1194074 NA other upstream 1426610 62070109 ~ 62070835 (-)

Expression


G1192818 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1192818 Expression in each Bioproject

Bar chart with 7 bars.
G1192818 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 14.
End of interactive chart.

Co-expression Network