G1193465



Basic Information


Item Value
gene id G1193465
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 61452741 ~ 61452959 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1361558
AGGATATATATAACTCACAGGGCCACAGGTTCCCCCATGTGAGAAGCCTGGACACTTCCCAAGCTACCTGATACTCCACAACCATGAAAAGCGCTACAGACAAGTCATGTATTTCTATTGCTATTACTAACCTTTTTACAGAGACTAGAGGAAGAGGGGTGTATGGGGGCTGATTCTTTCCGTATTGGTCCTGGCTCTAAACATATGGCCCTAGAAAAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1361558 True 219 lncRNA 0.45 1 61452741 61452959
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110538808 LOC106601873 coding downstream 426490 61005929 ~ 61026251 (-)
LOC110486976 LOC106606471 coding downstream 886807 60460043 ~ 60565934 (-)
LOC110486979 LOC106606406 coding downstream 1044021 60403617 ~ 60408720 (-)
LOC118936527 LOC106606405 coding downstream 1065780 60377853 ~ 60386961 (-)
LOC110486987 cyp2k4 coding downstream 1114314 60274725 ~ 60367022 (-)
LOC110486965 LOC100135781 coding upstream 93306 61546265 ~ 61550711 (-)
LOC110512085 LOC106601929 coding upstream 493693 61946652 ~ 62016705 (-)
LOC110487040 LOC106606439 coding upstream 566746 62019705 ~ 62025559 (-)
LOC110487033 LOC106606440 coding upstream 577717 62030676 ~ 62064793 (-)
LOC110487041 LOC105013038 coding upstream 614145 62067104 ~ 62098264 (-)
G1193446 NA non-coding downstream 18163 61433223 ~ 61434578 (-)
G1193445 NA non-coding downstream 19959 61432312 ~ 61432782 (-)
G1193444 NA non-coding downstream 21322 61431220 ~ 61431419 (-)
G1193443 NA non-coding downstream 21729 61430508 ~ 61431012 (-)
G1193413 NA non-coding downstream 25998 61419388 ~ 61426743 (-)
G1193477 NA non-coding upstream 13261 61466220 ~ 61466503 (-)
G1193495 NA non-coding upstream 28748 61481707 ~ 61482390 (-)
G1193500 NA non-coding upstream 37047 61490006 ~ 61493145 (-)
G1193528 NA non-coding upstream 79848 61532807 ~ 61533059 (-)
G1193542 NA non-coding upstream 99789 61552748 ~ 61553551 (-)
G1193386 NA other downstream 175083 61275745 ~ 61277658 (-)
G1192815 NA other downstream 810556 60641675 ~ 60642185 (-)
G1192757 NA other downstream 877544 60572370 ~ 60575197 (-)
G1193568 NA other upstream 131815 61584774 ~ 61585260 (-)
G1194074 NA other upstream 617150 62070109 ~ 62070835 (-)
LOC118938342 LOC106606436 other upstream 711176 62164135 ~ 62174550 (-)
G1194306 LOC106600182 other upstream 1002945 62455904 ~ 62499352 (-)

Expression


G1193465 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1193465 Expression in each Bioproject

Bar chart with 4 bars.
G1193465 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 12.
End of interactive chart.

Co-expression Network