G1193742



Basic Information


Item Value
gene id G1193742
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 61788988 ~ 61846023 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1361856
tggacgggctcgtgagtggggcacggcaatctgggaggcaagggctgagtgtactaaccagtatcaggactttaaggaggagatgatacgggtttttgatcgatctgtttttggggaggaggcttccagggccctggcttccctatgtcaaggcaatcgatccataacagactactctattgagtttcgcactcttgctgcctccagtggctggaacgagccggctttgctcgctcgtcttctggagggtctccgcgcagaggtaaaggatgagattctctcccgggaggtcccttccagcgtggattccctgattgaactcgctattcgcattgagcgacgggttgatcttcgtcaccgagctcgtggaaaggagcttgcgt

Function


NR:

description
Retrotransposon-derived protein PEG10

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1361856 True 383 TUCP 0.55 2 61788988 61846023

Neighbor


gene id symbol gene type direction distance location
LOC110538832 NA coding upstream 394645 61249492 ~ 61394343 (+)
LOC110514624 LOC105012866 coding upstream 785643 60925443 ~ 61003345 (+)
LOC110486968 LOC106606458 coding upstream 917444 60869364 ~ 60871544 (+)
LOC110486975 LOC106606457 coding upstream 1003272 60784142 ~ 60785716 (+)
LOC100136292 LOC100136292 coding upstream 1106293 60678389 ~ 60682695 (+)
LOC118938098 NA coding downstream 98351 61944374 ~ 61945360 (+)
LOC110487048 LOC106601931 coding downstream 182962 62028985 ~ 62030505 (+)
LOC118938343 LOC100194517 coding downstream 517313 62363336 ~ 62371232 (+)
LOC110487067 cant1 coding downstream 525414 62371437 ~ 62381775 (+)
LOC110487068 LOC106606433 coding downstream 550981 62397004 ~ 62404890 (+)
G1193679 NA non-coding upstream 76272 61712131 ~ 61712716 (+)
G1193678 NA non-coding upstream 80201 61708112 ~ 61708787 (+)
G1193607 NA non-coding upstream 159733 61628893 ~ 61629255 (+)
G1193603 NA non-coding upstream 164398 61624260 ~ 61624590 (+)
G1193598 NA non-coding upstream 167341 61621402 ~ 61621647 (+)
G1193796 NA non-coding downstream 5385 61851408 ~ 61851792 (+)
G1193797 NA non-coding downstream 6964 61852987 ~ 61853297 (+)
G1193798 NA non-coding downstream 7319 61853342 ~ 61853542 (+)
G1193802 NA non-coding downstream 10573 61856596 ~ 61856842 (+)
G1193805 NA non-coding downstream 13181 61859204 ~ 61859563 (+)
G1193515 NA other upstream 265918 61522404 ~ 61523070 (+)
LOC110515874 LOC106601846 other upstream 1335644 60431856 ~ 60458629 (+)
LOC118938341 NA other upstream 1482026 60304345 ~ 60307074 (+)
G1191844 NA other upstream 1667848 60064762 ~ 60121140 (+)
LOC110485258 LOC106606416 other upstream 1750427 60020410 ~ 60041199 (+)
G1193964 LOC106606437 other downstream 272462 62118416 ~ 62121427 (+)
G1193989 NA other downstream 343702 62189725 ~ 62191046 (+)
LOC110485308 LOC106601924 other downstream 754838 62569908 ~ 62605641 (+)
G1194696 LOC106601958 other downstream 1117586 62963609 ~ 62979131 (+)
G1194739 NA other downstream 1244280 63090303 ~ 63091342 (+)

Expression


G1193742 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1193742 Expression in each Bioproject

Bar chart with 20 bars.
G1193742 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network