G1194706



Basic Information


Item Value
gene id G1194706
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 63005631 ~ 63005955 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1363060
gtccagtgtgtgtgagtgtgtgggtagagtccagtgtgtatgagtgtgtgggtagagtccagtgtgtgtgagtgtgtgggtagagtccagtatgtgtgagtgtgtgggtagagtccagtgtgtatgagtgtgtgggtagagtccagtatgtgtgagtgtgtgggtagagtccagtgtgtatgagtgtgtgggtagagtccagtgtgtatgagtgtgtgggtagagtccagtgtgtgtgagtgtgtgggtagagtccagtgtgtatgagtgtgtgggtagagtccagtgtgtgtgagtgtgtgggtagagtccagtgtgtgggtag

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1363060 True 325 lncRNA 0.52 1 63005631 63005955
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110486092 LOC106601958 coding upstream 24938 62976416 ~ 62980693 (+)
LOC110486094 LOC106601958 coding upstream 37610 62963715 ~ 62968021 (+)
LOC110485137 LOC106606428 coding upstream 149351 62850736 ~ 62856280 (+)
socs3 socs3 coding upstream 226878 62775224 ~ 62778753 (+)
LOC110487087 cyh1 coding upstream 269916 62607624 ~ 62735715 (+)
LOC118938099 NA coding downstream 248919 63254874 ~ 63307318 (+)
hid1a LOC104925062 coding downstream 303541 63309496 ~ 63348219 (+)
LOC110487153 LOC106606395 coding downstream 371233 63377188 ~ 63406484 (+)
LOC110487432 LOC106606393 coding downstream 403956 63409911 ~ 63418900 (+)
fa18b LOC106602067 coding downstream 415951 63421906 ~ 63426370 (+)
G1194682 NA non-coding upstream 47830 62957590 ~ 62957801 (+)
G1194638 NA non-coding upstream 107306 62897641 ~ 62898325 (+)
G1194631 NA non-coding upstream 109969 62891737 ~ 62895662 (+)
G1194626 NA non-coding upstream 119378 62886052 ~ 62886253 (+)
G1194617 NA non-coding upstream 128698 62876119 ~ 62876933 (+)
G1194709 NA non-coding downstream 16404 63022359 ~ 63025764 (+)
G1194710 NA non-coding downstream 17260 63023215 ~ 63025887 (+)
G1194702 NA non-coding downstream 23500 63029455 ~ 63032073 (+)
G1194711 NA non-coding downstream 26557 63032512 ~ 63033811 (+)
G1194712 LOC106601916 non-coding downstream 31229 63037184 ~ 63037492 (+)
G1194696 LOC106601958 other upstream 26500 62963609 ~ 62979131 (+)
LOC110485308 LOC106601924 other upstream 402884 62569908 ~ 62605641 (+)
G1193989 NA other upstream 814585 62189725 ~ 62191046 (+)
G1193964 LOC106606437 other upstream 884204 62118416 ~ 62121427 (+)
G1193742 NA other upstream 1159608 61788988 ~ 61846023 (+)
G1194739 NA other downstream 84348 63090303 ~ 63091342 (+)
G1194741 LOC106606381 other downstream 97345 63103300 ~ 63104094 (+)
LOC118936377 LOC106606343 other downstream 680068 63686009 ~ 63692526 (+)
LOC110487456 LOC106593034 other downstream 694816 63700749 ~ 63714263 (+)
G1195223 NA other downstream 746993 63752948 ~ 63754685 (+)

Expression


G1194706 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1194706 Expression in each Bioproject

Bar chart with 6 bars.
G1194706 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network