G1194712 (LOC106601916)



Basic Information


Item Value
gene id G1194712
gene name LOC106601916
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 63037184 ~ 63037492 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1363068
TTGCTGTCGCGGTGCCTCTTGCCCAACTTGGTCTCCTCTGGGTGGTAGAACCACTTGACCTTCACCACCATGTTGGAGCTCCAGGATTCCCAGAAGTTCTCGATGCGGCCCACGTAGGGGAGGTGGGGCCGGCCGGCAGAGAGGAACATGGCACAGTCGCCCACTCGCACCATGTCCCTTCCCCGTACGATGGCCTTGTAGAACAGCTTCCTGGACTTCCCCTTCAGCCCCCGCCTCTGTGGAGACACAGGAACACTCAGAACACACAGTCATGTCTAGGAACTAGGGAGTGGGATTCAATACAACTCA

Function


NR:

description
BAH and coiled-coil domain-containing protein 1-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1363068 True 309 lncRNA 0.58 1 63037184 63037492

Neighbor


gene id symbol gene type direction distance location
LOC110486092 LOC106601958 coding upstream 56491 62976416 ~ 62980693 (+)
LOC110486094 LOC106601958 coding upstream 69163 62963715 ~ 62968021 (+)
LOC110485137 LOC106606428 coding upstream 180904 62850736 ~ 62856280 (+)
socs3 socs3 coding upstream 258431 62775224 ~ 62778753 (+)
LOC118938347 NA coding upstream 310613 62723924 ~ 62726571 (+)
LOC118938099 NA coding downstream 217382 63254874 ~ 63307318 (+)
hid1a LOC104925062 coding downstream 272004 63309496 ~ 63348219 (+)
LOC110487153 LOC106606395 coding downstream 339696 63377188 ~ 63406484 (+)
LOC110487432 LOC106606393 coding downstream 372419 63409911 ~ 63418900 (+)
fa18b LOC106602067 coding downstream 384414 63421906 ~ 63426370 (+)
G1194711 NA non-coding upstream 3373 63032512 ~ 63033811 (+)
G1194702 NA non-coding upstream 5111 63029455 ~ 63032073 (+)
G1194710 NA non-coding upstream 11297 63023215 ~ 63025887 (+)
G1194709 NA non-coding upstream 11420 63022359 ~ 63025764 (+)
G1194706 NA non-coding upstream 31229 63005631 ~ 63005955 (+)
G1194714 NA non-coding downstream 2384 63039876 ~ 63040089 (+)
G1194721 LOC106595340 non-coding downstream 13246 63050738 ~ 63055457 (+)
G1194726 NA non-coding downstream 22349 63059841 ~ 63060125 (+)
G1194728 NA non-coding downstream 24360 63061852 ~ 63062094 (+)
G1194732 NA non-coding downstream 32229 63069721 ~ 63069979 (+)
G1194696 LOC106601958 other upstream 58053 62963609 ~ 62979131 (+)
LOC110485308 LOC106601924 other upstream 434437 62569908 ~ 62605641 (+)
G1193989 NA other upstream 846138 62189725 ~ 62191046 (+)
G1193964 LOC106606437 other upstream 915757 62118416 ~ 62121427 (+)
G1193742 NA other upstream 1191161 61788988 ~ 61846023 (+)
G1194739 NA other downstream 52811 63090303 ~ 63091342 (+)
G1194741 LOC106606381 other downstream 65808 63103300 ~ 63104094 (+)
LOC118936377 LOC106606343 other downstream 648531 63686009 ~ 63692526 (+)
LOC110487456 LOC106593034 other downstream 663279 63700749 ~ 63714263 (+)
G1195223 NA other downstream 715456 63752948 ~ 63754685 (+)

Expression


G1194712(LOC106601916) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1194712(LOC106601916) Expression in each Bioproject

Bar chart with 12 bars.
G1194712(LOC106601916) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 35.
End of interactive chart.

Co-expression Network