G1194918



Basic Information


Item Value
gene id G1194918
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 63067914 ~ 63068300 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1363340
ctatagaaacactaccatagagagaaacactaccatagaaacactaccatagaaacactaccatagagagaaacactaccatagagagaaacactaccatagagagaaacactactgtagagagaaacactaccatagaaacactaccatagatagaaacactaccatagaaacactaccatagatagaaacactaccacagaaacactaccatagaaacactaccatagagagaaacactaccatagagagaaacactaccatagaaacactaccatagaaacactaccatagagagaaacactactatagaaacactaccatagagagaaacactaccatagaaacact

Function


NR:

description
uncharacterized protein LOC110507216

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1363340 True 351 lncRNA 0.37 2 63067914 63068300
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110487151 LOC105012845 coding downstream 110508 62937168 ~ 62957406 (-)
LOC118938348 LOC106606427 coding downstream 140995 62899607 ~ 62926919 (-)
LOC110487064 lg3bp coding downstream 555485 62506293 ~ 62512429 (-)
LOC118938345 LOC106595712 coding downstream 568724 62495039 ~ 62499190 (-)
LOC118938346 LOC106606432 coding downstream 593490 62469918 ~ 62474424 (-)
LOC110517310 LOC106601910 coding upstream 238881 63307181 ~ 63309144 (-)
LOC110487088 otop2 coding upstream 288185 63356485 ~ 63361782 (-)
LOC110487424 otop2 coding upstream 301392 63369692 ~ 63399197 (-)
LOC110485274 LOC106606392 coding upstream 351049 63419349 ~ 63421498 (-)
LOC110487426 LOC106606390 coding upstream 380195 63448495 ~ 63461634 (-)
G1194907 NA non-coding downstream 24994 63040323 ~ 63042920 (-)
G1194906 NA non-coding downstream 28567 63037564 ~ 63039347 (-)
G1194905 NA non-coding downstream 31242 63036447 ~ 63036672 (-)
G1194904 NA non-coding downstream 32823 63034284 ~ 63035091 (-)
G1194885 NA non-coding downstream 36654 63029690 ~ 63031260 (-)
G1194928 NA non-coding upstream 29626 63097926 ~ 63098147 (-)
G1194929 NA non-coding upstream 34407 63102707 ~ 63103006 (-)
G1194931 NA non-coding upstream 52217 63120517 ~ 63120817 (-)
G1194934 NA non-coding upstream 70525 63138825 ~ 63139634 (-)
G1194943 NA non-coding upstream 100903 63169203 ~ 63169413 (-)
G1194684 NA other downstream 130841 62935786 ~ 62937073 (-)
G1194521 NA other downstream 332204 62730954 ~ 62735710 (-)
G1194306 LOC106600182 other downstream 608016 62455904 ~ 62499352 (-)
G1194933 NA other upstream 68740 63137040 ~ 63137722 (-)
LOC110485277 LOC106602060 other upstream 428798 63495359 ~ 63509387 (-)
G1195624 NA other upstream 876776 63945076 ~ 63945764 (-)
LOC110487482 LOC106606373 other upstream 1266393 64334669 ~ 64362841 (-)
G1195997 NA other upstream 1408670 64476970 ~ 64477372 (-)

Expression


G1194918 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G1194918 Expression in each Bioproject

Bar chart with 16 bars.
G1194918 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network