G1194931



Basic Information


Item Value
gene id G1194931
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 63120517 ~ 63120817 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1363354
ctggggacaccgtgcgctccacagcataacacggtgcctgcccggtctctctagcccaccggtaaccacaggaagttggctcaggtctcctacctggcgtagccatactccctgttagccccccccccaagaaatttttggggctgactcccgggcttccatccacgacgccgcgctgcctcctcataccagcgcctctccgctttcgccgcctcccgttcttccttggggcggcgatactctcctggctgagcccaaggtcctttaccgtctaattcgtcctcccatgtccatacctcct

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1363354 True 301 lncRNA 0.62 1 63120517 63120817
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110487151 LOC105012845 coding downstream 163111 62937168 ~ 62957406 (-)
LOC118938348 LOC106606427 coding downstream 193598 62899607 ~ 62926919 (-)
LOC110487064 lg3bp coding downstream 608088 62506293 ~ 62512429 (-)
LOC118938345 LOC106595712 coding downstream 621327 62495039 ~ 62499190 (-)
LOC118938346 LOC106606432 coding downstream 646093 62469918 ~ 62474424 (-)
LOC110517310 LOC106601910 coding upstream 186364 63307181 ~ 63309144 (-)
LOC110487088 otop2 coding upstream 235668 63356485 ~ 63361782 (-)
LOC110487424 otop2 coding upstream 248875 63369692 ~ 63399197 (-)
LOC110485274 LOC106606392 coding upstream 298532 63419349 ~ 63421498 (-)
LOC110487426 LOC106606390 coding upstream 327678 63448495 ~ 63461634 (-)
G1194929 NA non-coding downstream 17511 63102707 ~ 63103006 (-)
G1194928 NA non-coding downstream 22370 63097926 ~ 63098147 (-)
G1194918 NA non-coding downstream 52217 63067914 ~ 63068300 (-)
G1194907 NA non-coding downstream 77597 63040323 ~ 63042920 (-)
G1194906 NA non-coding downstream 81170 63037564 ~ 63039347 (-)
G1194934 NA non-coding upstream 18008 63138825 ~ 63139634 (-)
G1194943 NA non-coding upstream 48386 63169203 ~ 63169413 (-)
G1194945 NA non-coding upstream 52157 63172974 ~ 63173185 (-)
G1194948 NA non-coding upstream 56543 63177360 ~ 63177684 (-)
G1194949 NA non-coding upstream 58297 63179114 ~ 63179366 (-)
LOC110486089 LOC106606381 other downstream 38944 63032412 ~ 63218815 (-)
G1194684 NA other downstream 183444 62935786 ~ 62937073 (-)
G1194521 NA other downstream 384807 62730954 ~ 62735710 (-)
G1194933 NA other upstream 16223 63137040 ~ 63137722 (-)
LOC110485277 LOC106602060 other upstream 376281 63495359 ~ 63509387 (-)
G1195624 NA other upstream 824259 63945076 ~ 63945764 (-)
LOC110487482 LOC106606373 other upstream 1213876 64334669 ~ 64362841 (-)
G1195997 NA other upstream 1356153 64476970 ~ 64477372 (-)

Expression


G1194931 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1194931 Expression in each Bioproject

Bar chart with 20 bars.
G1194931 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network