G1194992



Basic Information


Item Value
gene id G1194992
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 63275001 ~ 63275221 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1363419
ctaacaacaccacagtctaaccctaacaacaccacagtctaaccctaacaacaccacagtctaaccctaacaacaccacagtctaaccctaacaacaccacaggctaaccctaacaacaccacagtctaaccctaacaacaccacagtctaaccctaacaacaccacagtctaaccctaacaacaccacagtctaaccctaacaacaccacagtctaaccc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1363419 True 221 lncRNA 0.46 1 63275001 63275221

Neighbor


gene id symbol gene type direction distance location
LOC110486089 LOC106606381 coding downstream 56186 63032412 ~ 63218815 (-)
LOC110487151 LOC105012845 coding downstream 317595 62937168 ~ 62957406 (-)
LOC118938348 LOC106606427 coding downstream 348082 62899607 ~ 62926919 (-)
LOC110487064 lg3bp coding downstream 762572 62506293 ~ 62512429 (-)
LOC118938345 LOC106595712 coding downstream 775811 62495039 ~ 62499190 (-)
LOC110517310 LOC106601910 coding upstream 31960 63307181 ~ 63309144 (-)
LOC110487088 otop2 coding upstream 81264 63356485 ~ 63361782 (-)
LOC110487424 otop2 coding upstream 94471 63369692 ~ 63399197 (-)
LOC110485274 LOC106606392 coding upstream 144128 63419349 ~ 63421498 (-)
LOC110487426 LOC106606390 coding upstream 173274 63448495 ~ 63461634 (-)
G1194988 NA non-coding downstream 21396 63248672 ~ 63253605 (-)
G1194987 NA non-coding downstream 34242 63239697 ~ 63240759 (-)
G1194963 NA non-coding downstream 72757 63201627 ~ 63202244 (-)
G1194957 NA non-coding downstream 82321 63190315 ~ 63192680 (-)
G1194949 NA non-coding downstream 95635 63179114 ~ 63179366 (-)
G1194993 NA non-coding upstream 6118 63281339 ~ 63281679 (-)
G1195001 NA non-coding upstream 29164 63304385 ~ 63306063 (-)
G1195018 NA non-coding upstream 61720 63336941 ~ 63340383 (-)
G1195021 NA non-coding upstream 70213 63345434 ~ 63346313 (-)
G1195023 NA non-coding upstream 72440 63347661 ~ 63366471 (-)
G1194933 NA other downstream 137279 63137040 ~ 63137722 (-)
G1194684 NA other downstream 337928 62935786 ~ 62937073 (-)
G1194521 NA other downstream 539291 62730954 ~ 62735710 (-)
LOC110485277 LOC106602060 other upstream 221877 63495359 ~ 63509387 (-)
G1195624 NA other upstream 669855 63945076 ~ 63945764 (-)
LOC110487482 LOC106606373 other upstream 1059472 64334669 ~ 64362841 (-)
G1195997 NA other upstream 1201749 64476970 ~ 64477372 (-)
G1196113 NA other upstream 1519427 64794648 ~ 64795071 (-)

Expression


G1194992 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1194992 Expression in each Bioproject

Bar chart with 8 bars.
G1194992 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network