G1196147



Basic Information


Item Value
gene id G1196147
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 64905631 ~ 64908686 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1364891
gcgaggctatatacagacactggttagtcaggctgattgaggtagtatgtacatgtagatatggttaagtgactatgcagatatgatgaacagagagtagcagtagaggctatatacagtagagaggctatatacagacaccggttagtcaggctgattgaggtagtatgtacatgtagatatggttagtgactatgcagatatgatgaacagagagtagcagtagaggctatatacagacaccggttagtcaggctgattgaggtagtatgtacatgtagatatggttaagtgactatgcagatatgatgaacagagagtagcagtagag
>TU1364889
gcgaggctatatacagacactggttagtcaggctgattgaggtagtatgtacatgtagatatggttaagtgactatgcagatatgatgaacagagagtagcagtagaggctatatacagtagagaggctatatacagacaccggttagtcaggctgattgaggtaggatgtacatgtagatatggttaaagtgactgcagatatgatgaacagagagtagcagtagaggctatatacagtagagaggctatatacagacaccggttagtcaggctgattgaggtaggatgtacatgtagatatggttaaagtgactatgcagatatgatgaacagagtagcagtagaggctatatacagacaccggttagtcaggctgattgaggtaggatgttcatgtagatatggttaagtgactatgcagatatgatgaacagagtagcagtagaggctatatacagacaccggttagtcaggctgattgaggtaggatgt
>TU1364888
cagtagaggctatatacagacaccggttagtcaggctgattgaggtagtatgtacatgtagatatggttaaagtgactatgcagatatgatgaacagagagtagcagtagaggctatatacagtagagaggctatgtacagacactggttagtcaggctgattgaggtaggatgtacatgtagatatggttaaagtgactgcagatatgatgaacagagagtagcagtagaggctatatacagtagagaggctatatacagacaccggttagtcaggctgattgaggtagtatgtac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1364891 False 331 lncRNA 0.41 2 64905631 64908686
TU1364889 False 494 lncRNA 0.42 3 64906033 64908686
TU1364888 True 297 lncRNA 0.42 2 64907290 64907690
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110486630 LOC106601477 coding downstream 230598 64667592 ~ 64675033 (-)
LOC110510722 LOC106606296 coding downstream 243590 64641877 ~ 64662041 (-)
LOC110511879 LOC106606293 coding downstream 250144 64653378 ~ 64655487 (-)
LOC110513424 LOC106606290 coding downstream 265586 64627174 ~ 64640045 (-)
LOC110487475 NA coding downstream 280891 64614816 ~ 64624740 (-)
LOC118938356 NA coding upstream 42857 64951543 ~ 64954224 (-)
LOC110487107 LOC106606311 coding upstream 43968 64952654 ~ 64963823 (-)
LOC118936529 LOC105012854 coding upstream 60490 64969176 ~ 65045461 (-)
LOC118938357 LOC106595583 coding upstream 579262 65487948 ~ 65503404 (-)
LOC118938101 LOC106603827 coding upstream 1311379 66220065 ~ 66267701 (-)
G1196138 NA non-coding downstream 22731 64881193 ~ 64882900 (-)
G1196123 NA non-coding downstream 59213 64845942 ~ 64846418 (-)
G1196119 NA non-coding downstream 76666 64828698 ~ 64828965 (-)
LOC110487480 LOC106606286 non-coding downstream 104694 64798656 ~ 64945651 (-)
G1196112 NA non-coding downstream 112044 64792828 ~ 64793587 (-)
G1196149 NA non-coding upstream 975 64909661 ~ 64912439 (-)
G1196150 NA non-coding upstream 5333 64914019 ~ 64914395 (-)
G1196157 NA non-coding upstream 22489 64931175 ~ 64931475 (-)
G1196206 NA non-coding upstream 37149 64945835 ~ 64946577 (-)
G1196208 NA non-coding upstream 48592 64957278 ~ 64961176 (-)
G1196113 NA other downstream 110560 64794648 ~ 64795071 (-)
G1195997 NA other downstream 428259 64476970 ~ 64477372 (-)
LOC110487482 LOC106606373 other downstream 558224 64334669 ~ 64362841 (-)
G1195624 NA other downstream 959867 63945076 ~ 63945764 (-)
LOC110485277 LOC106602060 other downstream 1400107 63495359 ~ 63509387 (-)
G1196205 LOC106606311 other upstream 43104 64951790 ~ 64963785 (-)
G1196409 NA other upstream 344593 65253279 ~ 65254078 (-)
G1196536 emp2 other upstream 560761 65446633 ~ 65472652 (-)

Expression


G1196147 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1196147 Expression in each Bioproject

Bar chart with 18 bars.
G1196147 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network