G1196232



Basic Information


Item Value
gene id G1196232
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 65014602 ~ 65015106 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1365018
GTACTAGACATGGTAGAGTTCTGCTAGAGGCCAGTACTAGACATGGGAGAGTTCTGCTAGAGGCCAGTACTAGACATGGTAGAGTTCTGCTAGAGGCCAGTACTAGACATGGTAGAGTTCTACTAGAGGCCAGTACTAGACATGGGAGAGTTCTGCTAGAGGCCAGTACTAGACATGGTAGAGTTCTGCTAGAGGCCAGTACTAGACATGGTAGAGTTCTACTAGAGGTCAGTACTAGACA

Function


NR:

description
PREDICTED: uncharacterized protein LOC106568137 isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1365018 True 241 lncRNA 0.48 2 65014602 65015106
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110487107 LOC106606311 coding downstream 50779 64952654 ~ 64963823 (-)
LOC118938356 NA coding downstream 60378 64951543 ~ 64954224 (-)
LOC110487480 LOC106606286 coding downstream 68951 64798656 ~ 64945651 (-)
LOC110486630 LOC106601477 coding downstream 339569 64667592 ~ 64675033 (-)
LOC110511879 LOC106606293 coding downstream 359115 64653378 ~ 64655487 (-)
LOC118938357 LOC106595583 coding upstream 472842 65487948 ~ 65503404 (-)
LOC118938101 LOC106603827 coding upstream 1204959 66220065 ~ 66267701 (-)
LOC118938102 LOC106603753 coding upstream 1210044 66225150 ~ 66385923 (-)
LOC118938480 NA coding upstream 1408491 66423597 ~ 66424229 (-)
LOC118938476 LOC106603753 coding upstream 1419283 66434389 ~ 66435647 (-)
G1196229 NA non-coding downstream 3041 65011081 ~ 65011561 (-)
G1196224 NA non-coding downstream 18941 64995396 ~ 64995661 (-)
LOC118936529 LOC105012854 non-coding downstream 44567 64969176 ~ 65045461 (-)
G1196214 NA non-coding downstream 46299 64967886 ~ 64968303 (-)
G1196210 NA non-coding downstream 47653 64966651 ~ 64966949 (-)
G1196234 NA non-coding upstream 2118 65017224 ~ 65017788 (-)
G1196236 NA non-coding upstream 7633 65022739 ~ 65023187 (-)
G1196239 NA non-coding upstream 14086 65029192 ~ 65030031 (-)
G1196242 NA non-coding upstream 24751 65039857 ~ 65040359 (-)
G1196322 NA non-coding upstream 60620 65075726 ~ 65076056 (-)
G1196205 LOC106606311 other downstream 50817 64951790 ~ 64963785 (-)
G1196208 NA other downstream 53426 64957278 ~ 64961176 (-)
G1196113 NA other downstream 219531 64794648 ~ 64795071 (-)
G1195997 NA other downstream 537230 64476970 ~ 64477372 (-)
LOC110487482 LOC106606373 other downstream 667195 64334669 ~ 64362841 (-)
G1196409 NA other upstream 238173 65253279 ~ 65254078 (-)
G1196536 emp2 other upstream 454341 65446633 ~ 65472652 (-)
G1196797 NA other upstream 775617 65790723 ~ 65795435 (-)
G1196818 NA other upstream 842712 65857818 ~ 65859372 (-)

Expression


G1196232 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1196232 Expression in each Bioproject

Bar chart with 8 bars.
G1196232 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network