G1196322



Basic Information


Item Value
gene id G1196322
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 65075726 ~ 65076056 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1365157
agtaccccctgtatataacctccacactgactcggtactggtaccccctgtatataacctccacactgactcggtactggtaccccctgtatatagcctccacactgactcggtaccggtaccccctgtatataacctccacactgactcggtaccggtaccccctgtatataacctccacactgactcggtaccagtacacccctgtatatagcc
>TU1365158
gtaccccctgtatataacctccacactgactcggtactggtaccccctgtatataacctccacactgactcggtactggtaccccctgtatatagcctccacactgactcggtaccggtaccccctgtatataacctccacactgactcggtaccggtaccccctgtatataacctccacactgactcggtaccagtacacccctgtatatagcc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1365157 False 216 lncRNA 0.52 2 65075726 65076018
TU1365158 True 215 lncRNA 0.53 3 65075726 65076056

Neighbor


gene id symbol gene type direction distance location
LOC118936529 LOC105012854 coding downstream 30265 64969176 ~ 65045461 (-)
LOC110487107 LOC106606311 coding downstream 111903 64952654 ~ 64963823 (-)
LOC118938356 NA coding downstream 121502 64951543 ~ 64954224 (-)
LOC110487480 LOC106606286 coding downstream 130075 64798656 ~ 64945651 (-)
LOC110486630 LOC106601477 coding downstream 400693 64667592 ~ 64675033 (-)
LOC118938357 LOC106595583 coding upstream 411892 65487948 ~ 65503404 (-)
LOC118938101 LOC106603827 coding upstream 1144009 66220065 ~ 66267701 (-)
LOC118938102 LOC106603753 coding upstream 1149094 66225150 ~ 66385923 (-)
LOC118938480 NA coding upstream 1347541 66423597 ~ 66424229 (-)
LOC118938476 LOC106603753 coding upstream 1358333 66434389 ~ 66435647 (-)
G1196242 NA non-coding downstream 35367 65039857 ~ 65040359 (-)
G1196239 NA non-coding downstream 45695 65029192 ~ 65030031 (-)
G1196236 NA non-coding downstream 52539 65022739 ~ 65023187 (-)
G1196234 NA non-coding downstream 57938 65017224 ~ 65017788 (-)
G1196232 NA non-coding downstream 60620 65014602 ~ 65015106 (-)
G1196311 NA non-coding upstream 24918 65100974 ~ 65106227 (-)
G1196359 NA non-coding upstream 109347 65185403 ~ 65186626 (-)
G1196389 NA non-coding upstream 160611 65236667 ~ 65238604 (-)
G1196394 NA non-coding upstream 166536 65242592 ~ 65242847 (-)
G1196397 NA non-coding upstream 168553 65244609 ~ 65244842 (-)
G1196205 LOC106606311 other downstream 111941 64951790 ~ 64963785 (-)
G1196208 NA other downstream 114550 64957278 ~ 64961176 (-)
G1196113 NA other downstream 280655 64794648 ~ 64795071 (-)
G1195997 NA other downstream 598354 64476970 ~ 64477372 (-)
LOC110487482 LOC106606373 other downstream 728319 64334669 ~ 64362841 (-)
G1196409 NA other upstream 177223 65253279 ~ 65254078 (-)
G1196536 emp2 other upstream 393391 65446633 ~ 65472652 (-)
G1196797 NA other upstream 714667 65790723 ~ 65795435 (-)
G1196818 NA other upstream 781762 65857818 ~ 65859372 (-)

Expression


G1196322 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G1196322 Expression in each Bioproject

Bar chart with 20 bars.
G1196322 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network